ID: 1023550436

View in Genome Browser
Species Human (GRCh38)
Location 7:41364626-41364648
Sequence AACCCTGTGCTGGAACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023550434_1023550436 11 Left 1023550434 7:41364592-41364614 CCAATTGTTGATAAAATCACTAG No data
Right 1023550436 7:41364626-41364648 AACCCTGTGCTGGAACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023550436 Original CRISPR AACCCTGTGCTGGAACAGCC AGG Intergenic
No off target data available for this crispr