ID: 1023551147

View in Genome Browser
Species Human (GRCh38)
Location 7:41371031-41371053
Sequence ATGTTGTTGGAAAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023551144_1023551147 -4 Left 1023551144 7:41371012-41371034 CCAAGTAAATTTATTTTTGATGT No data
Right 1023551147 7:41371031-41371053 ATGTTGTTGGAAAGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023551147 Original CRISPR ATGTTGTTGGAAAGGAAAAA AGG Intergenic
No off target data available for this crispr