ID: 1023556126

View in Genome Browser
Species Human (GRCh38)
Location 7:41424647-41424669
Sequence AGTCTTTCATTGGGCACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023556126_1023556133 23 Left 1023556126 7:41424647-41424669 CCACTGGTGCCCAATGAAAGACT No data
Right 1023556133 7:41424693-41424715 TTGTCTTGTTCAACTGGGCCAGG No data
1023556126_1023556129 -7 Left 1023556126 7:41424647-41424669 CCACTGGTGCCCAATGAAAGACT No data
Right 1023556129 7:41424663-41424685 AAAGACTCTAGAAAAACCAGAGG No data
1023556126_1023556134 27 Left 1023556126 7:41424647-41424669 CCACTGGTGCCCAATGAAAGACT No data
Right 1023556134 7:41424697-41424719 CTTGTTCAACTGGGCCAGGTTGG No data
1023556126_1023556131 17 Left 1023556126 7:41424647-41424669 CCACTGGTGCCCAATGAAAGACT No data
Right 1023556131 7:41424687-41424709 AGTAGATTGTCTTGTTCAACTGG No data
1023556126_1023556132 18 Left 1023556126 7:41424647-41424669 CCACTGGTGCCCAATGAAAGACT No data
Right 1023556132 7:41424688-41424710 GTAGATTGTCTTGTTCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023556126 Original CRISPR AGTCTTTCATTGGGCACCAG TGG (reversed) Intergenic