ID: 1023558141

View in Genome Browser
Species Human (GRCh38)
Location 7:41444815-41444837
Sequence CAAAATGAGGAGAAGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023558141_1023558148 0 Left 1023558141 7:41444815-41444837 CCTGGCACCTTCTCCTCATTTTG No data
Right 1023558148 7:41444838-41444860 GGGTGCCAGATGCAATTGGTAGG No data
1023558141_1023558150 22 Left 1023558141 7:41444815-41444837 CCTGGCACCTTCTCCTCATTTTG No data
Right 1023558150 7:41444860-41444882 GCAAACATATTCCACCTGAATGG No data
1023558141_1023558147 -4 Left 1023558141 7:41444815-41444837 CCTGGCACCTTCTCCTCATTTTG No data
Right 1023558147 7:41444834-41444856 TTTGGGGTGCCAGATGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023558141 Original CRISPR CAAAATGAGGAGAAGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr