ID: 1023559615

View in Genome Browser
Species Human (GRCh38)
Location 7:41460047-41460069
Sequence GTGAGCCTGCTCTTCGGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023559610_1023559615 19 Left 1023559610 7:41460005-41460027 CCGTGTTTACTGTCTGGCTCCTT No data
Right 1023559615 7:41460047-41460069 GTGAGCCTGCTCTTCGGCATGGG No data
1023559611_1023559615 0 Left 1023559611 7:41460024-41460046 CCTTTTCTGAAGAGCATTGTCCT No data
Right 1023559615 7:41460047-41460069 GTGAGCCTGCTCTTCGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023559615 Original CRISPR GTGAGCCTGCTCTTCGGCAT GGG Intergenic
No off target data available for this crispr