ID: 1023565833

View in Genome Browser
Species Human (GRCh38)
Location 7:41522866-41522888
Sequence GAGTGATGGAGGGTGGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023565824_1023565833 19 Left 1023565824 7:41522824-41522846 CCAGAACCTCTCTCCAAAGAGAG No data
Right 1023565833 7:41522866-41522888 GAGTGATGGAGGGTGGTATCAGG No data
1023565827_1023565833 6 Left 1023565827 7:41522837-41522859 CCAAAGAGAGTGCACATGGACAG No data
Right 1023565833 7:41522866-41522888 GAGTGATGGAGGGTGGTATCAGG No data
1023565825_1023565833 13 Left 1023565825 7:41522830-41522852 CCTCTCTCCAAAGAGAGTGCACA No data
Right 1023565833 7:41522866-41522888 GAGTGATGGAGGGTGGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023565833 Original CRISPR GAGTGATGGAGGGTGGTATC AGG Intergenic
No off target data available for this crispr