ID: 1023567514

View in Genome Browser
Species Human (GRCh38)
Location 7:41538339-41538361
Sequence TGTTGGTCCTGATTTTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023567514_1023567519 -3 Left 1023567514 7:41538339-41538361 CCTAGGGAAAATCAGGACCAACA No data
Right 1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG No data
1023567514_1023567517 -10 Left 1023567514 7:41538339-41538361 CCTAGGGAAAATCAGGACCAACA No data
Right 1023567517 7:41538352-41538374 AGGACCAACATGAGGCTAGAGGG No data
1023567514_1023567521 5 Left 1023567514 7:41538339-41538361 CCTAGGGAAAATCAGGACCAACA No data
Right 1023567521 7:41538367-41538389 CTAGAGGGAAGCAGGGCCTTTGG No data
1023567514_1023567520 -2 Left 1023567514 7:41538339-41538361 CCTAGGGAAAATCAGGACCAACA No data
Right 1023567520 7:41538360-41538382 CATGAGGCTAGAGGGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023567514 Original CRISPR TGTTGGTCCTGATTTTCCCT AGG (reversed) Intergenic
No off target data available for this crispr