ID: 1023567519

View in Genome Browser
Species Human (GRCh38)
Location 7:41538359-41538381
Sequence ACATGAGGCTAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023567514_1023567519 -3 Left 1023567514 7:41538339-41538361 CCTAGGGAAAATCAGGACCAACA No data
Right 1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG No data
1023567513_1023567519 2 Left 1023567513 7:41538334-41538356 CCATTCCTAGGGAAAATCAGGAC No data
Right 1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023567519 Original CRISPR ACATGAGGCTAGAGGGAAGC AGG Intergenic
No off target data available for this crispr