ID: 1023568944

View in Genome Browser
Species Human (GRCh38)
Location 7:41552868-41552890
Sequence TCTGCAAGGCAGCAGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023568944_1023568951 21 Left 1023568944 7:41552868-41552890 CCTGCCAGCTGCTGCCTTGCAGA No data
Right 1023568951 7:41552912-41552934 AGCAGTGAACAAGGCTCTGTGGG No data
1023568944_1023568949 12 Left 1023568944 7:41552868-41552890 CCTGCCAGCTGCTGCCTTGCAGA No data
Right 1023568949 7:41552903-41552925 TGCTGCACTAGCAGTGAACAAGG No data
1023568944_1023568953 27 Left 1023568944 7:41552868-41552890 CCTGCCAGCTGCTGCCTTGCAGA No data
Right 1023568953 7:41552918-41552940 GAACAAGGCTCTGTGGGTGTGGG No data
1023568944_1023568950 20 Left 1023568944 7:41552868-41552890 CCTGCCAGCTGCTGCCTTGCAGA No data
Right 1023568950 7:41552911-41552933 TAGCAGTGAACAAGGCTCTGTGG No data
1023568944_1023568952 26 Left 1023568944 7:41552868-41552890 CCTGCCAGCTGCTGCCTTGCAGA No data
Right 1023568952 7:41552917-41552939 TGAACAAGGCTCTGTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023568944 Original CRISPR TCTGCAAGGCAGCAGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr