ID: 1023570816

View in Genome Browser
Species Human (GRCh38)
Location 7:41569617-41569639
Sequence CTCTAGAAGCAGAAGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023570813_1023570816 6 Left 1023570813 7:41569588-41569610 CCAGGAAGTTTCTAGAATTCCAG No data
Right 1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG No data
1023570812_1023570816 7 Left 1023570812 7:41569587-41569609 CCCAGGAAGTTTCTAGAATTCCA No data
Right 1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023570816 Original CRISPR CTCTAGAAGCAGAAGCAAGA AGG Intergenic
No off target data available for this crispr