ID: 1023574745

View in Genome Browser
Species Human (GRCh38)
Location 7:41615194-41615216
Sequence CATACTCTGCTGAAGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023574745_1023574749 2 Left 1023574745 7:41615194-41615216 CCTACCTCCTTCAGCAGAGTATG No data
Right 1023574749 7:41615219-41615241 AAGCTGAAAGAATACTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023574745 Original CRISPR CATACTCTGCTGAAGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr