ID: 1023576528

View in Genome Browser
Species Human (GRCh38)
Location 7:41634357-41634379
Sequence TCCCTAAGTTCCCCTAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023576526_1023576528 3 Left 1023576526 7:41634331-41634353 CCAAAATATTTTGTTTATTCCTG No data
Right 1023576528 7:41634357-41634379 TCCCTAAGTTCCCCTAAGACTGG No data
1023576525_1023576528 20 Left 1023576525 7:41634314-41634336 CCTTCTTTGATGCTTCTCCAAAA No data
Right 1023576528 7:41634357-41634379 TCCCTAAGTTCCCCTAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023576528 Original CRISPR TCCCTAAGTTCCCCTAAGAC TGG Intergenic
No off target data available for this crispr