ID: 1023581892

View in Genome Browser
Species Human (GRCh38)
Location 7:41692412-41692434
Sequence AGTTCTCTGCAGCAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 1, 2: 7, 3: 216, 4: 423}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023581889_1023581892 19 Left 1023581889 7:41692370-41692392 CCTGAGATGTTTACGGTACTATA 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1023581892 7:41692412-41692434 AGTTCTCTGCAGCAGAAGGCAGG 0: 1
1: 1
2: 7
3: 216
4: 423
1023581888_1023581892 20 Left 1023581888 7:41692369-41692391 CCCTGAGATGTTTACGGTACTAT 0: 1
1: 0
2: 0
3: 10
4: 77
Right 1023581892 7:41692412-41692434 AGTTCTCTGCAGCAGAAGGCAGG 0: 1
1: 1
2: 7
3: 216
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023581892 Original CRISPR AGTTCTCTGCAGCAGAAGGC AGG Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903220513 1:21866665-21866687 GGTCCTCTGCAGCAGAAGTAAGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905529820 1:38669008-38669030 ATTTCTCTGCAGGAAAAAGCAGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909471911 1:76038996-76039018 AGTTGTCTGCAGGAGAAAGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918958242 1:191237947-191237969 AGTTGTCTTCAGAAGATGGCAGG - Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919713682 1:200753422-200753444 AGTTCTCTGCAGGAGCTGACTGG + Intronic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920729012 1:208465129-208465151 ATTTGTCTGCAGCATGAGGCAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924760274 1:246978095-246978117 ATTTCTCTGTAGCAGAACACAGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066245062 10:33574762-33574784 GGTTCTATGTAGCAGAAGGGGGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067918213 10:50423482-50423504 AATTCTCAGAAGCAGAAGGAAGG + Intronic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068884222 10:62081771-62081793 ATTTCTCTACAGCAGAAGTCAGG - Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070260098 10:74846258-74846280 AGTTCTCTGTGGCAGAATGTGGG + Intronic
1070452758 10:76578595-76578617 TGTTAGCTGCAGGAGAAGGCTGG + Intergenic
1071130748 10:82390733-82390755 ACTTCTCTGCAGAAGAGGACTGG + Intronic
1071208759 10:83313836-83313858 ACTTCTGTGCATCAAAAGGCAGG + Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072434510 10:95403075-95403097 ACTTCTCTGCAGAAGAACGATGG + Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074031031 10:109688316-109688338 AGTGGACTGCAGCAGGAGGCAGG + Intergenic
1076541416 10:131217490-131217512 AGGACTCAGCAGCAGAGGGCTGG + Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077046070 11:545795-545817 TGTTCCCAGCAGCATAAGGCAGG + Intronic
1078056206 11:8010935-8010957 AGTTCTCTGCTGCAGAAGGCAGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081065464 11:38534904-38534926 AGTTGTCTGCAGGAGATGGCAGG + Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1083230648 11:61316388-61316410 AGAACTCTGCAGCAGAATGGAGG + Exonic
1083355293 11:62061739-62061761 ACTTTTCTGCAGCAGAACGGCGG - Intergenic
1083471474 11:62887192-62887214 AGTGCTATGCAAAAGAAGGCGGG + Intronic
1083704521 11:64504803-64504825 AGTTCTCTGCATCAGGGTGCTGG + Intergenic
1084147954 11:67275034-67275056 AGTTGTCTCCAGCAGGAAGCAGG - Intronic
1084947871 11:72648579-72648601 TCTTGTCTGCAGCAGATGGCTGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086332556 11:85768714-85768736 AGGTCTCTGCAGCAGGGGGTGGG - Intronic
1086561675 11:88175761-88175783 AGTACTCTGCGGGAGATGGCCGG + Intergenic
1087810661 11:102606402-102606424 TGTCCTATGCAGCAGAAGGGTGG - Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088587361 11:111370864-111370886 AATTATCTTCAGCAGAAGGTGGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1088988411 11:114929567-114929589 GGTGCCCTGCAGGAGAAGGCAGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090395654 11:126416435-126416457 ATTTCTCTGCAACAAAAGGGTGG + Intronic
1090873210 11:130766326-130766348 AGTGATCTGCAGGGGAAGGCAGG - Intergenic
1091032099 11:132199646-132199668 AGTTCCCAGCAGGAGAAAGCAGG - Intronic
1092002242 12:5042669-5042691 AGTTCCCTGCTGCAGAAGGCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092856213 12:12675913-12675935 AGTTCTGTACATCAGAAGTCTGG - Intronic
1092942951 12:13427634-13427656 GGACCTCTGCAGCAGGAGGCTGG + Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094047951 12:26187626-26187648 ACTTCTCTGCACCAGCAGGTGGG + Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096590659 12:52656942-52656964 AGATCATTGCAGAAGAAGGCAGG + Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097731451 12:63132898-63132920 TGTGCTCTGAAGCAGAGGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099946195 12:89247429-89247451 AGTTCTATGCAGCAGAAATGAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100978572 12:100146480-100146502 AATTCTTTCCTGCAGAAGGCAGG - Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101531286 12:105575713-105575735 AGTTCACTGAAGCAGGAAGCGGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102450416 12:113037807-113037829 AGTTGCCTGCAGGAGGAGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103600858 12:122053712-122053734 AGTTTTCTTTAGCAGAAGGAAGG - Intronic
1103877913 12:124142969-124142991 AGCTCTCTGCTGCAGACAGCAGG - Intronic
1105482500 13:20791991-20792013 CCTGCTCTGGAGCAGAAGGCTGG + Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107271615 13:38625193-38625215 AGCTCTCTCCTGCAGAAAGCGGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1108914305 13:55588898-55588920 ACTTATCTGCAGGAGATGGCAGG + Intergenic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113188097 13:107713046-107713068 CGTTCTCTGGAGCTGCAGGCAGG - Intronic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113412384 13:110101631-110101653 AGTGCAATGCTGCAGAAGGCAGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114647446 14:24263533-24263555 AGTTCTGTGCAGCCCAAGCCAGG + Intronic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115941804 14:38618294-38618316 AGTTCTCTGCACCAGAAGGAAGG - Intergenic
1115945726 14:38658012-38658034 AGTTCTGTTCAGCAGAAGAGTGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117401884 14:55365761-55365783 CTTTATCTGGAGCAGAAGGCTGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117721595 14:58634070-58634092 AGTGCTCTGCAGGAGGAAGCAGG + Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118685127 14:68283359-68283381 CGTACAGTGCAGCAGAAGGCTGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120374156 14:83678774-83678796 AGTTGTCTTCACCAGAAAGCTGG + Intergenic
1120445120 14:84585811-84585833 AGTTCACTGCAGGAGAAGGGAGG - Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1121993698 14:98585187-98585209 ATTTCACTACTGCAGAAGGCAGG - Intergenic
1202830467 14_GL000009v2_random:23325-23347 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1123768300 15:23503614-23503636 AGCTCTCTGCAGCAGAGAGTGGG + Intergenic
1124162547 15:27286281-27286303 ACTTCTCTCCAGCATAAAGCAGG + Intronic
1124620029 15:31268458-31268480 ACTTCCCTGAAACAGAAGGCAGG + Intergenic
1125130496 15:36278980-36279002 AGATCTCTGCACAAGAAGGGTGG + Intergenic
1125323582 15:38513954-38513976 AGATCTCTGCAGCAGTAGGAAGG - Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128502240 15:68234621-68234643 AGCTCTCAGCAGCAGACGGGAGG - Intronic
1128765193 15:70247101-70247123 AGACCTCTGCAGATGAAGGCTGG - Intergenic
1128781454 15:70361464-70361486 AGCCTTCTGCTGCAGAAGGCTGG - Intergenic
1128781455 15:70361466-70361488 AGCCTTCTGCAGCAGAAGGCTGG + Intergenic
1129537507 15:76326149-76326171 AGTTCTATAAATCAGAAGGCTGG - Intergenic
1131680603 15:94718488-94718510 AGTTCTATCAAGCAGAAGCCAGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134791512 16:16993456-16993478 ATTTCTCTCCAGCAGGAGCCAGG - Intergenic
1135984226 16:27172305-27172327 AGTTCTGGCCAGCAGAATGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137270420 16:46899419-46899441 TGTTCTCTGGGGCAGAGGGCTGG + Intronic
1137755724 16:50900671-50900693 AATTCGCTGAAGCAGCAGGCAGG - Intergenic
1137807521 16:51321398-51321420 TTTTCCCTGAAGCAGAAGGCAGG - Intergenic
1138070014 16:53983642-53983664 AGATCTCTGCAGAAGCCGGCAGG + Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139207577 16:65044110-65044132 AGCTCTCAGCAGCAGAAGGCAGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143958853 17:10697674-10697696 AGTTCCCTGCGGCTGGAGGCGGG + Intronic
1145406769 17:22605893-22605915 AGTTCTCTGCTGTTGAAGGTTGG + Intergenic
1145798562 17:27669573-27669595 ACTTCCCTGGAGCAGAAGCCAGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146706915 17:35007413-35007435 AAATCTCTCCAGCAGAATGCTGG + Exonic
1147249525 17:39144696-39144718 AGCTCTCTCCAGTGGAAGGCAGG - Intronic
1148948500 17:51287364-51287386 AGGTCACTGCAGCAATAGGCAGG + Intronic
1149380362 17:56087465-56087487 AGGTATCTAGAGCAGAAGGCAGG - Intergenic
1149586027 17:57787424-57787446 AGTTATCTGCACCCGAAAGCTGG - Intergenic
1150006425 17:61472037-61472059 AATTCTATGCAGCTGCAGGCCGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154199238 18:12287842-12287864 AGTCCGCTGCAGCTGCAGGCGGG + Intergenic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154254617 18:12771639-12771661 GGGTTTCTGCAGGAGAAGGCTGG + Intergenic
1154307567 18:13241687-13241709 AGCGCCCTGCAGCAGGAGGCTGG - Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156661044 18:39347079-39347101 AGGTCTCTGCACCAGCAGGATGG - Intergenic
1156898840 18:42277154-42277176 AGTTCTGAGTAGCAGAAGGATGG + Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157534612 18:48449083-48449105 AGTTCTCTCCCGCTGCAGGCAGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159040430 18:63319359-63319381 ATTTCTGTGAAGCAGAAGTCTGG - Exonic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160016031 18:75141435-75141457 AGTTCTCTGGACTAGAACGCTGG + Intergenic
1160871424 19:1279572-1279594 AGAGCTCTGCTGCAGGAGGCTGG + Intergenic
1163186778 19:15644413-15644435 AGTTCTCTGCTGGGGCAGGCTGG + Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1166130279 19:40741961-40741983 AGTGATCCGCAGCAGAGGGCTGG + Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202642226 1_KI270706v1_random:104454-104476 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
925859340 2:8159823-8159845 AGTGCTCTGTAGCGGAAAGCAGG - Intergenic
926643943 2:15268308-15268330 ACTTCTCTGCAGCAAACGTCTGG - Intronic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927382830 2:22498981-22499003 AGTTCTCTGCTGCTGAGGACTGG - Intergenic
929018360 2:37524992-37525014 ATTTCACTGAAGGAGAAGGCAGG + Intergenic
929449922 2:42030125-42030147 AATTCTCTGTGGCAGAAAGCAGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931148577 2:59547044-59547066 AGTTCTCTGCAGCTGGATGTTGG - Intergenic
931826727 2:66008059-66008081 AGTTGCATGCAGCAGAAAGCTGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933703597 2:85273703-85273725 TGTTCACTGCAGCAGAAGCCTGG + Intronic
933968044 2:87446475-87446497 AGTTCTGTGGGGCAGAAGTCTGG + Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
937685250 2:124689058-124689080 AGTTCTCTGAAGCAGGAGAATGG - Intronic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
938082357 2:128376935-128376957 TGTCCCCTGCAGCAGAAGGTGGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940445355 2:153770946-153770968 AGTTCTCTGCATGGGAAGGGGGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941821494 2:169848407-169848429 TGTTCTCTGCAAGAGAAGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943861148 2:192864066-192864088 AGATTTCTGCAGCAGATGCCAGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948367539 2:237467196-237467218 AGTTGTCTGCAGCTGGAGGTGGG - Intergenic
949010757 2:241677046-241677068 CCTTCTCTCCACCAGAAGGCAGG + Intronic
1169075908 20:2759713-2759735 ACTTCTCTGCAGCGAAAGGGTGG + Exonic
1169771063 20:9200982-9201004 GATCCTCAGCAGCAGAAGGCAGG + Intronic
1171224018 20:23425493-23425515 AGTGTTCTGCTTCAGAAGGCAGG + Intergenic
1171254582 20:23679789-23679811 AGATCTCTGCATGAGAAGGGAGG + Intergenic
1171772753 20:29338039-29338061 AATTCTCTGCCTCAGCAGGCTGG + Intergenic
1173480937 20:43398839-43398861 TTTTCTCTGGAGCGGAAGGCAGG - Intergenic
1174166442 20:48586887-48586909 ACTTCTTTGAAGCAGAAGCCTGG + Intergenic
1175773114 20:61636004-61636026 AGTCCTCTCCAGTACAAGGCAGG + Intronic
1175941102 20:62537872-62537894 GGTTTCCTCCAGCAGAAGGCAGG + Intergenic
1176609653 21:8868163-8868185 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177139421 21:17342298-17342320 GGTTATCTGCAGGAGACGGCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179429476 21:41310034-41310056 ACTTCCCTGCAGCACCAGGCTGG - Intronic
1179779609 21:43691014-43691036 AGAACTCTCCAGCAAAAGGCAGG + Intronic
1180359708 22:11877395-11877417 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180968560 22:19803080-19803102 GGCTCGCTGCATCAGAAGGCTGG + Intronic
1181267547 22:21639565-21639587 GGTGGTCTGCAGCAGGAGGCCGG + Intergenic
1181715982 22:24729239-24729261 AGCTCTCTGCAGCAGAGAGGGGG - Intronic
1183389747 22:37538777-37538799 AGTTGGCGGCAGCTGAAGGCTGG + Intergenic
1183511442 22:38237504-38237526 GTTTCTCTGCAGCAGAAGGCTGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1185175455 22:49323990-49324012 AGTTCTGTGCACCAGGAGGCCGG - Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952968549 3:38636548-38636570 AGCTCTCTGCTGCAGCAGCCGGG + Intronic
953805389 3:46063555-46063577 AGTCCTCAGAAGCACAAGGCAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955239532 3:57166707-57166729 AGTTCTGTGCAGCAGGAGCCAGG - Intronic
955369193 3:58336446-58336468 ATTTCCTTGCAGCAGAGGGCTGG - Intronic
955993687 3:64656129-64656151 AGTTCTCTGTACCAGAACACTGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957534033 3:81477723-81477745 AGTTCTCTTCAGTAAAAGGTAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960353214 3:116618574-116618596 AGCTCTCTGCAGCAGAGAGGGGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961371289 3:126433558-126433580 TGTTCTGAGCAGCAGAAGCCAGG + Intronic
962090526 3:132239648-132239670 TTCTCTCTGCAGCTGAAGGCTGG - Intronic
963504455 3:146165969-146165991 AGGTCTCTGCTGCAGATGTCAGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
963922581 3:150919950-150919972 AGATCTCTGCAACAGAAAGGAGG + Intronic
964203433 3:154144077-154144099 CTTTCACTGCAGCAGAAGCCAGG + Intronic
964652360 3:159026237-159026259 AGTTCTCTGCAGGGGCAGGGTGG + Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964728587 3:159840999-159841021 TGCTCTTTGCAGCAGCAGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965319654 3:167236855-167236877 AGTTTTATGAAGCAAAAGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966269262 3:178085014-178085036 AGAGATCTGCAGCAGGAGGCGGG + Intergenic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966490545 3:180523508-180523530 AGTTCCCTGAAGAAGAAGGAGGG - Intergenic
967307867 3:188076442-188076464 TGTTCTGTGCAGCTGATGGCTGG + Intergenic
967791462 3:193553446-193553468 AATACTCTTCACCAGAAGGCAGG - Intronic
1202736335 3_GL000221v1_random:2932-2954 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969154377 4:5197099-5197121 AGATGTCTGCAGGGGAAGGCAGG + Intronic
969575010 4:8031522-8031544 GGTTGTCTGGAGCAGGAGGCTGG + Intronic
969632726 4:8347773-8347795 GGTTCTCTGTAGCACATGGCAGG + Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972059210 4:34847235-34847257 GGCTCTCTGCAGCAGAATGAGGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973342042 4:49015384-49015406 ACTTCTCAACAGCAGAAGACAGG - Intronic
974019088 4:56677048-56677070 CTTTCTCAGGAGCAGAAGGCTGG - Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974630673 4:64483575-64483597 TGTTCTTTGTAGCAGAAGGGAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
975394886 4:73863428-73863450 AGTTGTCTGTAGCAGAAGTGTGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976664228 4:87572821-87572843 AGTTCTGTACATCAGAAGACTGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977270184 4:94908691-94908713 AGGTATCTGCAGCTGAAGACAGG + Intronic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978899080 4:113926848-113926870 TGTTATCTGCAGAAGACGGCAGG + Intronic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979456991 4:120937983-120938005 GGTTATCTGCAGCTGAAGGGAGG + Intergenic
979691047 4:123558980-123559002 TTCTCTCTGCAGCAGAGGGCTGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980311744 4:131140092-131140114 ATTTCTATTCAGCATAAGGCTGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981571369 4:146154206-146154228 AGGTCTCTTCTGCAGCAGGCAGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983016149 4:162615125-162615147 AGATCTGTGCAGGAGAAGTCTGG - Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984444864 4:179824275-179824297 AATTCTCTGCAGCAGCGGGGAGG - Intergenic
984744316 4:183199203-183199225 AATTCAGTGCAGCTGAAGGCTGG + Intronic
1202769598 4_GL000008v2_random:190334-190356 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987607907 5:20162329-20162351 AGTACTTTGCAGCAGAAAGCTGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988295455 5:29354573-29354595 TGTACTCTGCATCAGAATGCAGG + Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
993933464 5:93971819-93971841 AGGTCTCAGGAGCAGAAGGGAGG + Intronic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995106321 5:108381261-108381283 AACTCTTTGCAGCAGGAGGCGGG + Exonic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995622242 5:114039275-114039297 AGGTCTCTGCAAGAGAAGGGAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996823982 5:127660615-127660637 ATTTTTCTGCATCAAAAGGCAGG - Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998800477 5:145864167-145864189 AGATCTCAGAAGCTGAAGGCAGG + Intronic
999174617 5:149623282-149623304 GGATTCCTGCAGCAGAAGGCAGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000341186 5:160278516-160278538 TGGTCTCTGCAGCATATGGCAGG + Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002439245 5:179255833-179255855 GGGGCTCTGCAGCAGCAGGCAGG + Intronic
1002802793 6:542108-542130 AGTTCTCTATAGGAGAAGGTGGG + Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003133653 6:3416737-3416759 ACTTCTTTGCAGCAGAAGCAGGG - Intronic
1003192227 6:3884435-3884457 AGGTCTCTGTAGCACATGGCTGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004482214 6:16031773-16031795 AGCTCTCTGCAGCAGAGAGGGGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005605465 6:27472886-27472908 AGGCCTCTGCAGGAGAAAGCTGG - Intronic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006603840 6:35242843-35242865 AGGTCTCAGCAGCAAAAGGAAGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008099427 6:47375448-47375470 AACTCTGTTCAGCAGAAGGCAGG - Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1008936618 6:56999360-56999382 GGTTCTCTGCACAAGAAGGGTGG - Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013364844 6:109429271-109429293 AGGTCTGTGCAGAAGCAGGCTGG - Intronic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016273430 6:142318807-142318829 GGGTCTCTGCAGAAGAAGGTAGG + Intronic
1016495119 6:144652805-144652827 AGCTTTCTGCAGCAGTGGGCTGG - Intronic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1020812530 7:12864417-12864439 AGTTCACAGCTGCAGAAGGGAGG + Intergenic
1021652499 7:22845732-22845754 AGAGCTCTGCAGTAAAAGGCGGG + Intergenic
1022221189 7:28315477-28315499 AGTTTTCTGCAGCACCCGGCTGG - Intronic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1023497653 7:40815444-40815466 GGATCTCTGCACAAGAAGGCTGG + Intronic
1023581892 7:41692412-41692434 AGTTCTCTGCAGCAGAAGGCAGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024738379 7:52329767-52329789 ATTTCTCTGCAAGAGAAAGCAGG + Intergenic
1024888280 7:54169724-54169746 AGCTCTCTGCTGCAGAAAGGGGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027901451 7:84121141-84121163 TTTTCTCTGAAGTAGAAGGCTGG - Intronic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1028970948 7:96858394-96858416 AGTTCTGTCCATCAAAAGGCGGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030679739 7:112422416-112422438 AGAGCTCTGCAGCAGACTGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031437190 7:121747255-121747277 AGATATCAGCAGCAGAAGGTTGG - Intergenic
1031483454 7:122304079-122304101 AGGTCGCTGCAGCTGAATGCGGG + Exonic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031961175 7:127991297-127991319 AGCTCTCTGCATCAGGAGTCTGG - Intronic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033076711 7:138256691-138256713 AGCTCTCTGCAGCAGAGAGGTGG + Intergenic
1033673489 7:143515017-143515039 ATTTCTCTTCTGCAGAAGGTGGG - Intergenic
1034460016 7:151192981-151193003 AGATATGTGCAGCAGCAGGCTGG - Intronic
1034908924 7:154975930-154975952 AGTTAGCTGCAGCAAAACGCAGG - Exonic
1034944039 7:155250552-155250574 AGTTTTCTCCAGCAGGAGGAAGG + Intergenic
1035333608 7:158112201-158112223 AGTTCTCTGGAGGAGACAGCTGG + Intronic
1036436950 8:8743469-8743491 TGCTCCCTGCAGCAGGAGGCTGG - Intergenic
1037140289 8:15511227-15511249 ATTTCTCTCCAGTAGAAGGAGGG + Intronic
1037191203 8:16128180-16128202 GGATCTCTGCAGCACACGGCTGG - Intronic
1037197007 8:16202777-16202799 AGCTCTCTGCAGGACAAGGATGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038526155 8:28275293-28275315 TGTCCTCAGAAGCAGAAGGCAGG + Intergenic
1039615236 8:38950376-38950398 AGGTCTCTAGAGGAGAAGGCAGG - Intronic
1039794412 8:40900048-40900070 CGTCCTCTGCAGCAAATGGCAGG + Intergenic
1040883000 8:52228826-52228848 AGGTCTCTGCAGCAGAGACCTGG + Intronic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041468328 8:58180407-58180429 CGTTCTCTGCTGTAGGAGGCAGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042485134 8:69339370-69339392 GGTCCTCTGCAGCACACGGCAGG - Intergenic
1042782520 8:72507842-72507864 GGTTCTCTGCAGCCAAAGGCAGG - Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044733134 8:95248844-95248866 ATATCACTGCAACAGAAGGCAGG + Intronic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045995122 8:108353005-108353027 ATTACTGTGCAGCAGAAGACTGG + Intronic
1045995337 8:108355751-108355773 ATTACTATGCAGCAGAAGACTGG + Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046197552 8:110884193-110884215 CGTTATCTGCAGAAGAGGGCAGG - Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047372588 8:124268119-124268141 AAGTTTCTGCAGCAGATGGCAGG - Intergenic
1047555605 8:125926157-125926179 AGTTCCCTACGGCAGAAGGTTGG + Intergenic
1047769647 8:128020547-128020569 AGTTCCCTGCAGCTGTAGGCCGG - Intergenic
1048236200 8:132693092-132693114 AGGTGGCTGCAGCAGCAGGCTGG + Intronic
1048550270 8:135427405-135427427 CTTTCTCTCCAGGAGAAGGCAGG - Intergenic
1048667321 8:136677325-136677347 AGTTCTCAGAAGCAGAATGAGGG - Intergenic
1048885953 8:138909987-138910009 TGCTCACTGCAGCAGCAGGCAGG + Intronic
1049096528 8:140551580-140551602 AGTTGTCTGCATCACTAGGCAGG - Intronic
1049441471 8:142611716-142611738 AGTCGGCTGCAGCAGAGGGCAGG - Exonic
1049447449 8:142637915-142637937 AGGCCACTGGAGCAGAAGGCAGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058726209 9:107807054-107807076 GGTGGACTGCAGCAGAAGGCAGG - Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059341679 9:113601000-113601022 AGTTCTCTCCATCTGAAGTCGGG + Intergenic
1060471897 9:123954960-123954982 AGTCTTCCTCAGCAGAAGGCTGG - Intergenic
1062037235 9:134387911-134387933 AGTTCTTTGCTGCAAGAGGCTGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203694491 Un_GL000214v1:84061-84083 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
1203705064 Un_KI270742v1:33371-33393 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1203558945 Un_KI270744v1:32440-32462 ATTTCTCTGAAGAAGAATGCTGG - Intergenic
1203641782 Un_KI270751v1:20002-20024 ATTTCTCTGAAGAAGAATGCTGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1187415182 X:19087021-19087043 AGTTATATGCAGGAGAAGGTTGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189328364 X:40127304-40127326 AGTTCACTGCAGCTGACAGCTGG + Intronic
1190918548 X:54827765-54827787 AGTTCACTGTAGCAGATTGCAGG + Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193584601 X:83305580-83305602 TGGTCTGTGCAGTAGAAGGCAGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197433934 X:126401316-126401338 GGTTCTCAGCAGCAGATTGCTGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199170304 X:144727129-144727151 AGTGCTCTGCAGCTTCAGGCTGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201481947 Y:14449296-14449318 ATTTCACTGTAGAAGAAGGCAGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic