ID: 1023585534

View in Genome Browser
Species Human (GRCh38)
Location 7:41725879-41725901
Sequence CAGACACATGACACTGTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023585534_1023585535 0 Left 1023585534 7:41725879-41725901 CCAACTACAGTGTCATGTGTCTG No data
Right 1023585535 7:41725902-41725924 TGCACATGAGCCCACAGAGATGG No data
1023585534_1023585536 1 Left 1023585534 7:41725879-41725901 CCAACTACAGTGTCATGTGTCTG No data
Right 1023585536 7:41725903-41725925 GCACATGAGCCCACAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023585534 Original CRISPR CAGACACATGACACTGTAGT TGG (reversed) Intergenic
No off target data available for this crispr