ID: 1023591339

View in Genome Browser
Species Human (GRCh38)
Location 7:41783635-41783657
Sequence CTGTAGATGTGGAGAGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023591335_1023591339 17 Left 1023591335 7:41783595-41783617 CCTGGGTGACAGATACTGGTGGC No data
Right 1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG No data
1023591337_1023591339 -5 Left 1023591337 7:41783617-41783639 CCTGGACTGCAACAGCAGCTGTA No data
Right 1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023591339 Original CRISPR CTGTAGATGTGGAGAGAAGA CGG Intergenic
No off target data available for this crispr