ID: 1023594014

View in Genome Browser
Species Human (GRCh38)
Location 7:41810048-41810070
Sequence GTTAGAGCCCAGACTGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023594012_1023594014 0 Left 1023594012 7:41810025-41810047 CCTTCAACAGTCAGTGTCCAACA No data
Right 1023594014 7:41810048-41810070 GTTAGAGCCCAGACTGAAGCCGG No data
1023594011_1023594014 18 Left 1023594011 7:41810007-41810029 CCTTTTCTATATTGCTTTCCTTC No data
Right 1023594014 7:41810048-41810070 GTTAGAGCCCAGACTGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023594014 Original CRISPR GTTAGAGCCCAGACTGAAGC CGG Intergenic
No off target data available for this crispr