ID: 1023594402

View in Genome Browser
Species Human (GRCh38)
Location 7:41813738-41813760
Sequence CTGCAAATTTCTTGGAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023594398_1023594402 -8 Left 1023594398 7:41813723-41813745 CCAGCCTCCAAAGAGCTGCAAAT No data
Right 1023594402 7:41813738-41813760 CTGCAAATTTCTTGGAATCCAGG No data
1023594397_1023594402 -3 Left 1023594397 7:41813718-41813740 CCTGACCAGCCTCCAAAGAGCTG No data
Right 1023594402 7:41813738-41813760 CTGCAAATTTCTTGGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023594402 Original CRISPR CTGCAAATTTCTTGGAATCC AGG Intergenic
No off target data available for this crispr