ID: 1023594730

View in Genome Browser
Species Human (GRCh38)
Location 7:41816945-41816967
Sequence CCAAACCCACAGGTGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023594730_1023594734 10 Left 1023594730 7:41816945-41816967 CCTTTGACCACCTGTGGGTTTGG No data
Right 1023594734 7:41816978-41817000 TTCCATTTTTAGTCTTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023594730 Original CRISPR CCAAACCCACAGGTGGTCAA AGG (reversed) Intergenic
No off target data available for this crispr