ID: 1023597032

View in Genome Browser
Species Human (GRCh38)
Location 7:41840899-41840921
Sequence CTGAATCCACAGATCAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023597029_1023597032 15 Left 1023597029 7:41840861-41840883 CCACAAAATAACTAGTTGAGATT No data
Right 1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023597032 Original CRISPR CTGAATCCACAGATCAAGTT GGG Intergenic
No off target data available for this crispr