ID: 1023598097

View in Genome Browser
Species Human (GRCh38)
Location 7:41853682-41853704
Sequence CTCAGGTGTCCCAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023598097_1023598106 22 Left 1023598097 7:41853682-41853704 CCTGCTTCCCTGGGACACCTGAG No data
Right 1023598106 7:41853727-41853749 AGCTTCCCACCACCTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023598097 Original CRISPR CTCAGGTGTCCCAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr