ID: 1023599947

View in Genome Browser
Species Human (GRCh38)
Location 7:41872314-41872336
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023599947_1023599953 22 Left 1023599947 7:41872314-41872336 CCTAACCCACATATAACTGTGTC No data
Right 1023599953 7:41872359-41872381 GGGTTAAGCCTTTGAGATTTGGG No data
1023599947_1023599951 2 Left 1023599947 7:41872314-41872336 CCTAACCCACATATAACTGTGTC No data
Right 1023599951 7:41872339-41872361 CATTTAAAAATAAACATATTGGG No data
1023599947_1023599952 21 Left 1023599947 7:41872314-41872336 CCTAACCCACATATAACTGTGTC No data
Right 1023599952 7:41872358-41872380 TGGGTTAAGCCTTTGAGATTTGG No data
1023599947_1023599955 24 Left 1023599947 7:41872314-41872336 CCTAACCCACATATAACTGTGTC No data
Right 1023599955 7:41872361-41872383 GTTAAGCCTTTGAGATTTGGGGG No data
1023599947_1023599954 23 Left 1023599947 7:41872314-41872336 CCTAACCCACATATAACTGTGTC No data
Right 1023599954 7:41872360-41872382 GGTTAAGCCTTTGAGATTTGGGG No data
1023599947_1023599950 1 Left 1023599947 7:41872314-41872336 CCTAACCCACATATAACTGTGTC No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023599947 Original CRISPR GACACAGTTATATGTGGGTT AGG (reversed) Intergenic
No off target data available for this crispr