ID: 1023599948

View in Genome Browser
Species Human (GRCh38)
Location 7:41872319-41872341
Sequence ATGATGACACAGTTATATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023599948_1023599954 18 Left 1023599948 7:41872319-41872341 CCCACATATAACTGTGTCATCAT No data
Right 1023599954 7:41872360-41872382 GGTTAAGCCTTTGAGATTTGGGG No data
1023599948_1023599955 19 Left 1023599948 7:41872319-41872341 CCCACATATAACTGTGTCATCAT No data
Right 1023599955 7:41872361-41872383 GTTAAGCCTTTGAGATTTGGGGG No data
1023599948_1023599953 17 Left 1023599948 7:41872319-41872341 CCCACATATAACTGTGTCATCAT No data
Right 1023599953 7:41872359-41872381 GGGTTAAGCCTTTGAGATTTGGG No data
1023599948_1023599951 -3 Left 1023599948 7:41872319-41872341 CCCACATATAACTGTGTCATCAT No data
Right 1023599951 7:41872339-41872361 CATTTAAAAATAAACATATTGGG No data
1023599948_1023599950 -4 Left 1023599948 7:41872319-41872341 CCCACATATAACTGTGTCATCAT No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599948_1023599952 16 Left 1023599948 7:41872319-41872341 CCCACATATAACTGTGTCATCAT No data
Right 1023599952 7:41872358-41872380 TGGGTTAAGCCTTTGAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023599948 Original CRISPR ATGATGACACAGTTATATGT GGG (reversed) Intergenic
No off target data available for this crispr