ID: 1023599950

View in Genome Browser
Species Human (GRCh38)
Location 7:41872338-41872360
Sequence TCATTTAAAAATAAACATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023599946_1023599950 2 Left 1023599946 7:41872313-41872335 CCCTAACCCACATATAACTGTGT No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599949_1023599950 -5 Left 1023599949 7:41872320-41872342 CCACATATAACTGTGTCATCATT No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599947_1023599950 1 Left 1023599947 7:41872314-41872336 CCTAACCCACATATAACTGTGTC No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599941_1023599950 23 Left 1023599941 7:41872292-41872314 CCAGCCCTAGCATACCACTGCCC No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599948_1023599950 -4 Left 1023599948 7:41872319-41872341 CCCACATATAACTGTGTCATCAT No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599942_1023599950 19 Left 1023599942 7:41872296-41872318 CCCTAGCATACCACTGCCCCTAA No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599943_1023599950 18 Left 1023599943 7:41872297-41872319 CCTAGCATACCACTGCCCCTAAC No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599944_1023599950 9 Left 1023599944 7:41872306-41872328 CCACTGCCCCTAACCCACATATA No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data
1023599945_1023599950 3 Left 1023599945 7:41872312-41872334 CCCCTAACCCACATATAACTGTG No data
Right 1023599950 7:41872338-41872360 TCATTTAAAAATAAACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023599950 Original CRISPR TCATTTAAAAATAAACATAT TGG Intergenic
No off target data available for this crispr