ID: 1023599955

View in Genome Browser
Species Human (GRCh38)
Location 7:41872361-41872383
Sequence GTTAAGCCTTTGAGATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023599946_1023599955 25 Left 1023599946 7:41872313-41872335 CCCTAACCCACATATAACTGTGT No data
Right 1023599955 7:41872361-41872383 GTTAAGCCTTTGAGATTTGGGGG No data
1023599945_1023599955 26 Left 1023599945 7:41872312-41872334 CCCCTAACCCACATATAACTGTG No data
Right 1023599955 7:41872361-41872383 GTTAAGCCTTTGAGATTTGGGGG No data
1023599948_1023599955 19 Left 1023599948 7:41872319-41872341 CCCACATATAACTGTGTCATCAT No data
Right 1023599955 7:41872361-41872383 GTTAAGCCTTTGAGATTTGGGGG No data
1023599949_1023599955 18 Left 1023599949 7:41872320-41872342 CCACATATAACTGTGTCATCATT No data
Right 1023599955 7:41872361-41872383 GTTAAGCCTTTGAGATTTGGGGG No data
1023599947_1023599955 24 Left 1023599947 7:41872314-41872336 CCTAACCCACATATAACTGTGTC No data
Right 1023599955 7:41872361-41872383 GTTAAGCCTTTGAGATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023599955 Original CRISPR GTTAAGCCTTTGAGATTTGG GGG Intergenic
No off target data available for this crispr