ID: 1023602808

View in Genome Browser
Species Human (GRCh38)
Location 7:41896887-41896909
Sequence CTGGGCTTTTAGCTGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023602803_1023602808 14 Left 1023602803 7:41896850-41896872 CCCCTGCTTTTGGCAGCACTTTC No data
Right 1023602808 7:41896887-41896909 CTGGGCTTTTAGCTGTCTCCTGG No data
1023602805_1023602808 12 Left 1023602805 7:41896852-41896874 CCTGCTTTTGGCAGCACTTTCAA No data
Right 1023602808 7:41896887-41896909 CTGGGCTTTTAGCTGTCTCCTGG No data
1023602804_1023602808 13 Left 1023602804 7:41896851-41896873 CCCTGCTTTTGGCAGCACTTTCA No data
Right 1023602808 7:41896887-41896909 CTGGGCTTTTAGCTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023602808 Original CRISPR CTGGGCTTTTAGCTGTCTCC TGG Intergenic
No off target data available for this crispr