ID: 1023605273

View in Genome Browser
Species Human (GRCh38)
Location 7:41925520-41925542
Sequence AAAGGCTTGGTAAAGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023605273_1023605279 24 Left 1023605273 7:41925520-41925542 CCCTCACACTTTACCAAGCCTTT No data
Right 1023605279 7:41925567-41925589 GACCCCAAATCTTATTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023605273 Original CRISPR AAAGGCTTGGTAAAGTGTGA GGG (reversed) Intergenic
No off target data available for this crispr