ID: 1023609720

View in Genome Browser
Species Human (GRCh38)
Location 7:41960424-41960446
Sequence ACTACTACTTAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023609718_1023609720 4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1023609718 7:41960397-41960419 CCTCAGCTGATGGCTCAAAAGAC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 207
1023609715_1023609720 19 Complete closest: 452
total_pairs: 2
max_distance: 1000
Left 1023609715 7:41960382-41960404 CCCAGAAACAATTATCCTCAGCT 0: 1
1: 0
2: 0
3: 14
4: 212
Right 1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 207
1023609713_1023609720 24 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1023609713 7:41960377-41960399 CCCTTCCCAGAAACAATTATCCT 0: 1
1: 0
2: 3
3: 37
4: 508
Right 1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 207
1023609716_1023609720 18 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1023609716 7:41960383-41960405 CCAGAAACAATTATCCTCAGCTG 0: 1
1: 0
2: 3
3: 11
4: 188
Right 1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 207
1023609714_1023609720 23 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1023609714 7:41960378-41960400 CCTTCCCAGAAACAATTATCCTC 0: 1
1: 0
2: 1
3: 22
4: 178
Right 1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 207
1023609712_1023609720 28 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1023609712 7:41960373-41960395 CCTGCCCTTCCCAGAAACAATTA 0: 1
1: 0
2: 6
3: 21
4: 231
Right 1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023609720 Original CRISPR ACTACTACTTAGAAAGAGGA AGG Intergenic
904200215 1:28814651-28814673 ACTACCACTGAGCAAGGGGAGGG + Intronic
904552259 1:31328824-31328846 ACTTCTAGGAAGAAAGAGGAGGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
910449825 1:87333987-87334009 ACAACTAATTAAAAAGAAGATGG + Intronic
912771802 1:112470961-112470983 ACTACTCCTCAGGAAAAGGATGG - Intronic
913303726 1:117400692-117400714 ACTACTACTTAGCAATAAAAAGG - Intronic
913974423 1:143443241-143443263 ACCACTACATAGAAACAGGAAGG + Intergenic
914068813 1:144268855-144268877 ACCACTACATAGAAACAGGAAGG + Intergenic
914110342 1:144697499-144697521 ACCACTACATAGAAACAGGAAGG - Intergenic
914228658 1:145744266-145744288 GCCACTACTTAGATGGAGGAAGG - Exonic
917142423 1:171850103-171850125 AGGACTACTTAGCAAGAGTATGG + Intronic
917202311 1:172531072-172531094 GCAACTACTTGAAAAGAGGATGG + Intergenic
917592688 1:176493300-176493322 AGCATTACTTAGAAAGAGGGAGG - Intronic
918040461 1:180911321-180911343 GCTACTCCATAGACAGAGGAGGG + Intergenic
918513357 1:185335596-185335618 AGTATAACTTAGAAAGGGGATGG - Intergenic
919030836 1:192240062-192240084 AGTACTATGTAGAAAGAGCAGGG - Intergenic
919151232 1:193701566-193701588 AATGCTACATGGAAAGAGGAAGG + Intergenic
919530166 1:198707434-198707456 GCTACTGCTTGGAAAGAGGAGGG + Intronic
920905429 1:210160481-210160503 ACTATTACATAGAAATAGTAAGG + Intronic
921720395 1:218464585-218464607 AATACTACAAATAAAGAGGAGGG - Intergenic
921875737 1:220193810-220193832 ATAACTATTTAGAAAAAGGAAGG - Intronic
1065030656 10:21582686-21582708 ACCAGTATTTAGGAAGAGGAAGG + Intronic
1066049956 10:31624279-31624301 ACCACTGTTTAGAAAAAGGAAGG - Intergenic
1066680580 10:37933888-37933910 TCTACTACTAAGAAAGAGGCAGG - Intergenic
1067919038 10:50434164-50434186 ACTTCTTCTTGGAAAAAGGAAGG - Intronic
1069508917 10:69026046-69026068 ACAACTACTTAGAAACAAAATGG - Intergenic
1069811434 10:71162891-71162913 ACTACTTCTTAATAAGAGAAAGG + Intergenic
1072215475 10:93283909-93283931 ACTGTTTCTGAGAAAGAGGAAGG + Intergenic
1075355543 10:121770168-121770190 AATACTACTTAGCAATAAGAAGG + Intronic
1077446766 11:2596497-2596519 AATACTACTTAGAAATACAAAGG + Intronic
1078175876 11:8970001-8970023 ACTGCTATTTAAAAAGGGGAAGG - Intergenic
1079438042 11:20477692-20477714 GCTACTGCTTAGAAAGAAGAAGG - Intronic
1079633763 11:22710697-22710719 AAGACTTCTCAGAAAGAGGAAGG - Intronic
1079776496 11:24536952-24536974 ACTGCTTCTGAGGAAGAGGAAGG + Intronic
1080174076 11:29340915-29340937 ACTACTACTTCAAAAGATAAGGG + Intergenic
1085949067 11:81307558-81307580 ACAACTATGGAGAAAGAGGAAGG - Intergenic
1087108834 11:94440734-94440756 ACTACCTCTTAGAAAAATGAGGG - Intronic
1088185313 11:107160203-107160225 ACTCCCATTTAGAAAGAGTAAGG - Intergenic
1089123715 11:116161436-116161458 ACCACCACTAAGAAAAAGGAAGG + Intergenic
1089864459 11:121619780-121619802 ACTACAACGTAGTCAGAGGATGG - Exonic
1091248452 11:134120656-134120678 ACTACCACAAGGAAAGAGGACGG + Intronic
1092651912 12:10643990-10644012 AATACTACTTAGCAATAAGAAGG + Intronic
1092885277 12:12919327-12919349 ATTTCTTCTTAGAAAGAGAAAGG - Intergenic
1093255795 12:16866565-16866587 ACAACTTCTGTGAAAGAGGAAGG - Intergenic
1095478821 12:42612717-42612739 ACTTTTACTTAGGAAGAGCAAGG + Intergenic
1100109149 12:91216521-91216543 ACTATTACCGAGAAAAAGGAGGG + Intergenic
1100763903 12:97842035-97842057 CTTTCTAATTAGAAAGAGGAAGG + Intergenic
1100809360 12:98323472-98323494 ACTACTAGGGAGACAGAGGAAGG - Intergenic
1100954991 12:99897694-99897716 ACTAGTGCTTAGAACAAGGACGG + Intronic
1103618809 12:122173188-122173210 GTTAGTACTTAGAAAGAGGAAGG - Intronic
1107811455 13:44204317-44204339 AATACTACTTAGTAATAGAAAGG - Intergenic
1108893405 13:55292837-55292859 ACAAAAACTTTGAAAGAGGAGGG - Intergenic
1109247101 13:59968069-59968091 AATACTAGTTAGAAAGATTAAGG - Intronic
1110476143 13:75916287-75916309 AAAACAACTTAGAAAGTGGAAGG - Intergenic
1112549888 13:100409512-100409534 ACTTCCACATAGGAAGAGGAGGG + Intronic
1115105722 14:29759552-29759574 ACTACTGCTAAGAATGTGGAGGG - Intronic
1115413698 14:33106046-33106068 AGTGCTTCTTAGAAATAGGAAGG + Intronic
1115456261 14:33607313-33607335 ACTACTACTCAGCAATAGAAAGG + Intronic
1116748745 14:48853996-48854018 ACTACTACTTAGACATAAGAGGG - Intergenic
1118050512 14:62021367-62021389 CCTACATCTGAGAAAGAGGAAGG - Intronic
1120183425 14:81368409-81368431 ATTACTACTGTAAAAGAGGATGG + Intronic
1120248287 14:82031170-82031192 ATGACTACTTAAAAAGAGGAGGG + Intergenic
1120655760 14:87188190-87188212 ACTGCTGCTTTGAAATAGGAGGG - Intergenic
1121480026 14:94259895-94259917 ACTACTACTCAGAAATAAAAAGG - Intronic
1122613196 14:102999713-102999735 ACTACAAATTGGAAAGAGAAGGG + Exonic
1123154608 14:106212185-106212207 ACTTCTACCTGGTAAGAGGAGGG - Intergenic
1124162626 15:27287069-27287091 ACTACTAAGTAGAAAAATGAAGG - Intronic
1125965054 15:43867618-43867640 GCTACTGCTTAGAATGAAGAAGG + Exonic
1126483028 15:49148371-49148393 ACTACTTCTGAGTTAGAGGAAGG + Intronic
1127249895 15:57222439-57222461 CCTACTGCTTAAAAAGAGAAGGG + Intronic
1131569407 15:93519005-93519027 AATACTGCTTAGAAAGAAAAAGG + Intergenic
1131891331 15:96974697-96974719 AGAACTACCTAGAAATAGGATGG + Intergenic
1133087793 16:3378602-3378624 AATACTTCTTAGAGGGAGGAAGG - Intronic
1133591011 16:7243530-7243552 ACTACTACTAATAAAGAGTAAGG - Intronic
1133658778 16:7893692-7893714 AATGCTAATGAGAAAGAGGATGG + Intergenic
1135946410 16:26868828-26868850 GCTACTCCCTAGACAGAGGAGGG + Intergenic
1139117692 16:63976771-63976793 ACAATCGCTTAGAAAGAGGAAGG - Intergenic
1140448356 16:75050160-75050182 ACTACTACTTAGCAATAAAAAGG - Intronic
1141734413 16:85842735-85842757 ACTTCTACATAGAGAGAAGATGG + Intergenic
1143409226 17:6698441-6698463 AGGCCTACTGAGAAAGAGGAGGG - Intronic
1143574757 17:7785495-7785517 ACTACTTCTCAGATAGTGGAAGG + Intronic
1148535458 17:48434839-48434861 ATTACTATTTAGATGGAGGAGGG - Intergenic
1149365295 17:55937822-55937844 ACTACTATTTAGAAACAGAAGGG + Intergenic
1153107544 18:1545072-1545094 ACTACAGCTTAGACAGAAGAAGG - Intergenic
1155268248 18:24114667-24114689 ACTACTTCTTAACAAGAGGCTGG - Intronic
1155584764 18:27352201-27352223 AATACTACATAGAAAGAGTGAGG - Intergenic
1155757855 18:29524297-29524319 AATGATACTTAGATAGAGGATGG + Intergenic
1157380506 18:47211049-47211071 ACTACTACTAATAAAGATAATGG + Intergenic
1157800331 18:50615249-50615271 ACCACAACTTAGACAGAAGAGGG - Intronic
1158608566 18:58918162-58918184 ACGATTACTAAGAAAGAGCAAGG - Intronic
1158939181 18:62391180-62391202 ACTACTACTCAGAAAAAAAATGG - Exonic
1164947247 19:32306417-32306439 ACTACTATATATAAAGAAGAAGG - Intergenic
1167936676 19:52914405-52914427 ACTCCTACTTATAAAAAGAAAGG + Intergenic
926817097 2:16809503-16809525 AATACTACTCAGAAATAAGAAGG + Intergenic
926956102 2:18302462-18302484 AACACTACTAAGAAATAGGAAGG - Intronic
927162453 2:20279871-20279893 GCTAGTGCTTAGAAATAGGAAGG - Intronic
928886443 2:36154195-36154217 ACTGATACATGGAAAGAGGATGG - Intergenic
929772345 2:44902946-44902968 ACTACCACACAGAAAAAGGAGGG + Intergenic
931504276 2:62906981-62907003 AATACTACTTAGTAATAAGAAGG - Intronic
932308615 2:70721978-70722000 ACTATTAATAAGATAGAGGAAGG + Intronic
932668342 2:73716026-73716048 AGTCCTACATAGAATGAGGAAGG + Intergenic
933276796 2:80292463-80292485 AATACTACTCTGAACGAGGAGGG + Intronic
934179129 2:89604216-89604238 ACCACTACATAGAAACAGGAAGG + Intergenic
934289413 2:91678484-91678506 ACCACTACATAGAAACAGGAAGG + Intergenic
934514028 2:94973239-94973261 ACTTCTACCTGGTAAGAGGAGGG - Intergenic
934795763 2:97097638-97097660 AATACTACTTAGCAAGAAAAAGG + Intergenic
936007536 2:108904617-108904639 ACTACTACTCAGCAAGAGAGAGG + Intronic
936284345 2:111170337-111170359 ACTACTACTTAGTAATAAAAAGG - Intergenic
937806842 2:126155337-126155359 ACTACAAGTTAAAAAAAGGAAGG - Intergenic
937940009 2:127277932-127277954 GCTATTGCTTAGAAAGATGAAGG + Intronic
940266973 2:151849111-151849133 AGTTCTACTTTGGAAGAGGAAGG - Intronic
940268069 2:151861140-151861162 GCTACTTCCTAGAAAGAGCATGG - Intronic
941996737 2:171608361-171608383 AATACTACTCAGAAAGAAAAAGG + Intergenic
942319909 2:174727437-174727459 GCTACTCCTTAGACAGAGTAGGG - Intergenic
943190343 2:184669914-184669936 AATACAACTTAGTAAGAGAATGG - Intronic
943997529 2:194789105-194789127 GCTACTCCATAGAAAGAGCAGGG + Intergenic
944260919 2:197676031-197676053 ACTACTACCAAGAAAGAAAAAGG + Intronic
1173156318 20:40613920-40613942 AATACTACTTAGGAATAGAAAGG - Intergenic
1173160171 20:40646620-40646642 ATTACTACTTTGAGAAAGGAGGG + Intergenic
1176068571 20:63214099-63214121 ACAACTAATTAGAAGGGGGACGG + Intronic
1176291096 21:5045128-5045150 ACCACGACTCAGAAAGAGGCAGG - Intergenic
1177481190 21:21691347-21691369 ACTAATACTCAGAAAGTCGATGG + Intergenic
1177587081 21:23110932-23110954 ATTAGTAATTAGAAAGTGGAGGG + Intergenic
1177684027 21:24413779-24413801 ACTATAAATTAGAAAGAGAAAGG + Intergenic
1178727336 21:35065522-35065544 ACTAATGCAGAGAAAGAGGAGGG + Intronic
1179866159 21:44218513-44218535 ACCACGACTCAGAAAGAGGCAGG + Intergenic
1182644707 22:31798839-31798861 GCTACTCCATAGAAAGAGCAGGG + Intronic
1183107601 22:35626028-35626050 TCTACTACTTAGAAAGAAGTGGG + Intronic
950591509 3:13939007-13939029 GCTACTCCATAGAAAGAGTAGGG + Intronic
952709870 3:36419224-36419246 ACAAATGCTGAGAAAGAGGAGGG - Intronic
953965159 3:47298875-47298897 ACTACTACTGAGAAATATAAAGG - Intronic
954494457 3:50941701-50941723 ACTACTACTCAGAAACAAAAAGG + Intronic
956698669 3:71939927-71939949 ACAACTCCTTACAAAGAAGAAGG + Intergenic
956865275 3:73363186-73363208 ACTAATACTCAAACAGAGGATGG - Intergenic
956968784 3:74496477-74496499 ATAACAACTTTGAAAGAGGAAGG - Intronic
957533486 3:81470922-81470944 ACTACTCCTGAGAAAAAGAATGG - Intergenic
959670528 3:108972105-108972127 ACCACTGTTTAGAAAGAGCAGGG - Intronic
959828406 3:110830389-110830411 ACTACTACTCAGAAACAACAAGG - Intergenic
960988181 3:123293881-123293903 TCTACTACTAAGAATGAGGGAGG + Intronic
961062259 3:123839871-123839893 ACTAAAACTTAGTAACAGGAAGG + Intronic
962139209 3:132770973-132770995 ACTATTACTTAGCAAGAAAAAGG + Intergenic
964855326 3:161140220-161140242 GCTACTCCATAGACAGAGGAGGG - Intronic
965972608 3:174580689-174580711 AATACTACTTATAAATAAGAAGG - Intronic
966654302 3:182337478-182337500 AATACTACTCAGAAATAAGAAGG + Intergenic
967439844 3:189493844-189493866 ACTACTAATTATAAAGACGTAGG - Intergenic
969830153 4:9789400-9789422 ACCACTACATAGAAACAGGAAGG - Intronic
971080020 4:23199008-23199030 CTTACTACATAGAAAGAAGAGGG + Intergenic
971382170 4:26108937-26108959 ACTAACACTTATAAAGAGGATGG + Intergenic
972367523 4:38390426-38390448 ACCACACCTTAGAATGAGGAAGG - Intergenic
972420257 4:38879952-38879974 CCTGCTACTTAGGAAGAGGCAGG + Intronic
972426058 4:38934160-38934182 AGTACTAATTGGAAAGAAGAGGG + Intronic
973106459 4:46344694-46344716 ACTACTACACAGAAGGAGGAGGG + Intronic
977973395 4:103236935-103236957 AATACTACTTAGCAATATGAAGG + Intergenic
978891013 4:113827567-113827589 AGTACTACTGAGAAAGCAGAGGG + Intergenic
982987964 4:162233965-162233987 AGTACTTGTTACAAAGAGGAAGG - Intergenic
983046004 4:162986601-162986623 ACTACCTCTTAGAAAAATGAAGG + Intergenic
983197636 4:164825275-164825297 ACTACTACATAGAAATATGTGGG + Intergenic
985811880 5:2096201-2096223 TTTCCTTCTTAGAAAGAGGAAGG + Intergenic
986041602 5:3999367-3999389 AATACAACTTAGTAAAAGGAAGG - Intergenic
987635596 5:20536560-20536582 ACTACTTCTTATGAACAGGAAGG + Intronic
988809360 5:34769059-34769081 ACTACTTCTGAGGAACAGGAGGG - Intronic
989187754 5:38641513-38641535 AGTGCTACTTAGAAGTAGGATGG - Intergenic
990517814 5:56546874-56546896 AGGACTATTTAGAAAAAGGAGGG - Intronic
992610293 5:78502335-78502357 ATTACTGCTGAGAAAGAGGGAGG - Intronic
993876041 5:93308255-93308277 ACTACTATTAAGAAAAAGGTGGG + Intergenic
994569637 5:101499168-101499190 GCTACTACTTCCAAAGAAGAAGG - Intergenic
997416860 5:133735591-133735613 ACTATGACTCAGAAACAGGAAGG - Intergenic
998060322 5:139114028-139114050 AATGCTTGTTAGAAAGAGGATGG + Intronic
999063804 5:148663245-148663267 CATACTACATAGAAAGAGGGAGG + Intronic
1001579697 5:172790195-172790217 AGTACTTCTAAGAAAGAGGGAGG - Intergenic
1006765932 6:36506991-36507013 ACTACTACTTGGAAAATTGATGG - Intronic
1007028654 6:38605354-38605376 ACTAGTTCTTAGTAAGTGGATGG + Intronic
1008741865 6:54618283-54618305 AATACTAGTTATTAAGAGGATGG - Intergenic
1011074527 6:83424195-83424217 ACTACAACATAAATAGAGGAAGG + Intronic
1014809398 6:125869078-125869100 ATTTCTACTTAGATATAGGAAGG - Intronic
1016249718 6:142026379-142026401 GCTACTCCGTAGAAAGAGTAGGG + Intergenic
1019884350 7:3891144-3891166 ACTTCCACTGGGAAAGAGGATGG + Intronic
1020722713 7:11768515-11768537 AGTAGTACTTAGAAAGGGGAAGG - Intronic
1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG + Intergenic
1024090192 7:45932486-45932508 ACTACAACATAAAAAGGGGAGGG - Intergenic
1025855907 7:65278386-65278408 TCTACTACTTAGGAAGACGGGGG + Intergenic
1026885929 7:73945159-73945181 AGTACTACTTAGCAAGAAAAAGG - Intergenic
1027711848 7:81614171-81614193 TCTACTGCTTAGAAAAAGAAGGG + Intergenic
1027817294 7:82992233-82992255 ACTACTACAAAGAAAGATGTAGG + Intronic
1028547920 7:92025424-92025446 ACTATTAGTAAGAATGAGGACGG - Intronic
1029357081 7:100060169-100060191 AATGCTACTTAGAAAGATCAAGG + Intronic
1030223846 7:107126944-107126966 ACTACTAGCTAGTAAGAGAAAGG - Intronic
1030519308 7:110577969-110577991 ACTAATATTGAGAAAGAGAAAGG + Intergenic
1031472083 7:122177768-122177790 ACTACTTCTCAGAAATAAGAAGG - Intergenic
1033969269 7:147019104-147019126 AGTACTACTTAGAAAATGTAGGG - Intronic
1034195181 7:149240643-149240665 ACCACTACTTTGAAACAGTATGG - Intronic
1035139812 7:156748416-156748438 ACTACAACTTAGATAGGTGATGG - Intronic
1035920644 8:3672332-3672354 ACTACAACTGAAAAAGGGGAAGG - Intronic
1036576312 8:10030844-10030866 ACTACTACTTAGCAATAAAAAGG - Intergenic
1038147404 8:24911945-24911967 ACTACTGCTTATAAAAAGTAGGG - Intergenic
1040089237 8:43379442-43379464 AATACCACATAGAAAGAGAAAGG - Intergenic
1042172732 8:66008222-66008244 AAGACTACTTACAAAGATGAGGG - Intergenic
1043077973 8:75726557-75726579 AATACTATTTAAAAAGAGTAGGG + Intergenic
1043189024 8:77193545-77193567 AGTACTACTTTGAAAAGGGATGG - Intergenic
1043777185 8:84284793-84284815 AATACTAGTTAGAAAGAGCTTGG - Intronic
1044364010 8:91321995-91322017 ACTACTAGTAAGAAAGACAATGG - Intronic
1046148479 8:110192725-110192747 TCTACTAATTAAAAAGAAGAAGG - Intergenic
1046227525 8:111304168-111304190 ACAGCTACTTAGAAAGAAAATGG - Intergenic
1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG + Intronic
1047858006 8:128933802-128933824 AATACAACTTAGAAAAATGAGGG - Intergenic
1048225350 8:132579622-132579644 ACTACAACTAAGAAAGTGGGGGG + Intronic
1050273917 9:3976516-3976538 ACTCATACTTAGAAAGGGGAAGG - Intronic
1051722195 9:20048853-20048875 ACTAATAGTTAAAAATAGGATGG - Intergenic
1051766487 9:20529988-20530010 TCCACTACTGAGAAAGAGAAGGG + Intronic
1052282350 9:26747618-26747640 ACTGCTACTTAGCAAGAGGAAGG + Intergenic
1055114226 9:72589881-72589903 ATTACTATATTGAAAGAGGAAGG + Intronic
1056240229 9:84638132-84638154 ACTACTATTTAATAAAAGGAAGG + Intergenic
1058264094 9:102875727-102875749 ATTACTAATTAGAAAGAGCCTGG + Intergenic
1060512838 9:124246491-124246513 ACTGTTACTTCGAAGGAGGAGGG + Intergenic
1188369698 X:29353555-29353577 ACTAATACTTAGAAACAATAGGG + Intronic
1188499369 X:30809008-30809030 AATACTACTGAGAAAGACGGAGG - Intergenic
1188867847 X:35336209-35336231 TCTATTACTTAGAAAATGGAGGG + Intergenic
1189967920 X:46393188-46393210 GCTTCTAGATAGAAAGAGGACGG + Intergenic
1190212627 X:48460243-48460265 AGAACTAATTAGACAGAGGAGGG - Intronic
1190711333 X:53072867-53072889 ACTAGTACTTAGAAAGTGCTAGG - Intronic
1191693040 X:63960345-63960367 AATACTGCTTAGAAAGAGCTGGG + Intergenic
1192272796 X:69599165-69599187 ATTACTACTTAGCAACAGAAAGG + Intergenic
1193120471 X:77818032-77818054 ACTACTACATAGACAGAGTAGGG + Intergenic
1194003176 X:88457349-88457371 CATACTACTGATAAAGAGGAAGG - Intergenic
1194800044 X:98262003-98262025 ACTAGTCCTTTAAAAGAGGAAGG + Intergenic
1195119483 X:101736030-101736052 AATATTATTTAGAAAGAGGCTGG - Intergenic
1196134735 X:112196321-112196343 ACTACTACTCAGCAATAAGAAGG - Intergenic
1196868499 X:120090544-120090566 ACTACCACTTAGAAAAATGGGGG + Intergenic
1199912348 X:152300488-152300510 ATTAGTACTTAGAAAGAAAAAGG + Intronic
1200410672 Y:2857724-2857746 ACTCTGCCTTAGAAAGAGGAAGG - Intronic