ID: 1023610597

View in Genome Browser
Species Human (GRCh38)
Location 7:41966857-41966879
Sequence GAAGCTTCCTTTACAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023610590_1023610597 28 Left 1023610590 7:41966806-41966828 CCAACACGGCCACAGAGAGCAGT 0: 1
1: 0
2: 1
3: 9
4: 136
Right 1023610597 7:41966857-41966879 GAAGCTTCCTTTACAAAAACAGG No data
1023610591_1023610597 19 Left 1023610591 7:41966815-41966837 CCACAGAGAGCAGTGAGCAAGCA 0: 1
1: 0
2: 3
3: 26
4: 288
Right 1023610597 7:41966857-41966879 GAAGCTTCCTTTACAAAAACAGG No data
1023610588_1023610597 30 Left 1023610588 7:41966804-41966826 CCCCAACACGGCCACAGAGAGCA 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1023610597 7:41966857-41966879 GAAGCTTCCTTTACAAAAACAGG No data
1023610589_1023610597 29 Left 1023610589 7:41966805-41966827 CCCAACACGGCCACAGAGAGCAG 0: 1
1: 0
2: 3
3: 11
4: 155
Right 1023610597 7:41966857-41966879 GAAGCTTCCTTTACAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023610597 Original CRISPR GAAGCTTCCTTTACAAAAAC AGG Intronic
No off target data available for this crispr