ID: 1023618445

View in Genome Browser
Species Human (GRCh38)
Location 7:42045169-42045191
Sequence CTGGTATCCTTGAGCTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023618444_1023618445 -5 Left 1023618444 7:42045151-42045173 CCTGCATCTGTCAGTTCACTGGT 0: 1
1: 0
2: 0
3: 10
4: 181
Right 1023618445 7:42045169-42045191 CTGGTATCCTTGAGCTAAACAGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023618445 Original CRISPR CTGGTATCCTTGAGCTAAAC AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
914286790 1:146234225-146234247 CTGCTATGCTTGAGATAAGCAGG + Intergenic
914547821 1:148684965-148684987 CTGCTATGCTTGAGATAAGCAGG + Intergenic
915480013 1:156178031-156178053 CTTGTATCCTTCTGCTAGACAGG + Intergenic
916076869 1:161205904-161205926 TTTGGATCCTGGAGCTAAACAGG + Intronic
917578128 1:176345459-176345481 CTCATATTCTTGAGCAAAACCGG - Intergenic
919666487 1:200297657-200297679 CTGGTGTCATTGAGCTCAATGGG - Intergenic
924403478 1:243716166-243716188 CTGATATCCTTTACCTAAAGGGG + Intronic
1064833213 10:19494801-19494823 CTGGTATCCTTGAAAGAGACAGG + Intronic
1066065979 10:31761091-31761113 CTGGGATCCTTGAGGCAAGCAGG - Intergenic
1071791571 10:88959735-88959757 ATGGTATCCTTGAACAAAAAAGG - Intronic
1076434324 10:130429763-130429785 CTTCTCTCCTTGAGCTGAACAGG + Intergenic
1078485281 11:11716909-11716931 CAGGTCTCCTTGAGCTATAGTGG + Intergenic
1078691323 11:13583075-13583097 CTGGGATCTTTGACCTAAAGAGG - Intergenic
1078724134 11:13913439-13913461 CTGGTCTCCTTGAGAGAAATTGG - Intergenic
1084689428 11:70716438-70716460 GCGGTTTCCTTGAGCTCAACAGG - Intronic
1087032307 11:93717838-93717860 CTGGTATCCAGGAGCTGACCTGG - Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1091901522 12:4148002-4148024 CTGGTAGCCTTGAGGTAAGGTGG - Intergenic
1098702712 12:73648842-73648864 CTGGTATCAATGAGCACAACTGG - Intergenic
1104711560 12:130990514-130990536 CTGGAATCCTTGGGCTAGAGGGG + Intronic
1106199681 13:27525917-27525939 CTAGCATCCTTGAGCTAGTCAGG - Intergenic
1115336288 14:32246828-32246850 CTGATGGCCTTGAGCTAAAGGGG - Intergenic
1121739108 14:96238988-96239010 CTGGCATCCTGGAGCCAGACTGG - Intronic
1131612632 15:93981233-93981255 CTTCTATCCTTGAGCTAAAAGGG - Intergenic
1134681942 16:16132391-16132413 CTGGAACTCTTGAGCTCAACCGG + Intronic
1138282510 16:55782880-55782902 CTGGCGTTCCTGAGCTAAACAGG + Intergenic
1138286431 16:55813739-55813761 CTGGCGTTCCTGAGCTAAACAGG - Intronic
1150011240 17:61506121-61506143 CTGGTATCCTTGAGGAAAGGGGG - Intergenic
1150915733 17:69435038-69435060 ATGATATCCTTGAGCCCAACTGG - Intronic
1150985039 17:70186238-70186260 CTAGTATCCTTTAGTGAAACAGG + Intergenic
1155640587 18:28009051-28009073 TTGGTATCCTGGAGTAAAACTGG + Intronic
1155710465 18:28870810-28870832 CTGATATACTTGAGATACACTGG - Intergenic
1159459423 18:68704984-68705006 GTAGTATCCTTGAGCTAAAAAGG - Intronic
1160443276 18:78908747-78908769 CTGGTCTCCTTGATCTCAGCGGG - Intergenic
1161773895 19:6246988-6247010 CGGGTATCCTGGAATTAAACGGG + Intronic
1162600508 19:11664929-11664951 CAGGCATCACTGAGCTAAACTGG + Intergenic
1163621776 19:18365099-18365121 CTGGTAACCTTGAACTTACCAGG + Exonic
1164757152 19:30698478-30698500 ATGGTATCCTGGAGCAGAACAGG - Intronic
926341188 2:11906104-11906126 CAGGTTTCCCTGAGCTACACTGG - Intergenic
928151433 2:28833346-28833368 CTGGTATCTTTGAGGTAAGGAGG - Intronic
930618195 2:53615942-53615964 CTGGTATTCCTGAGTTAAACTGG - Intronic
931965267 2:67526426-67526448 CTGGAACACTTGAGCTACACTGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
941551317 2:166918853-166918875 CTGGTCTCCCTCATCTAAACCGG + Intronic
947223166 2:227814038-227814060 CTTTTAGCCTTGAGCTCAACTGG + Intronic
1171400815 20:24872125-24872147 CTGGAATCAATGAGATAAACGGG + Intergenic
1172289778 20:33767604-33767626 CTGTTATCCGTGAGCCAAAAGGG + Intronic
1173121799 20:40299171-40299193 CTGGTAGCCTTCAGTAAAACAGG + Intergenic
1174910292 20:54600786-54600808 CTGGAAAACTTGAGCTAGACAGG - Intronic
1184307473 22:43616002-43616024 ATGGTATCCTTGAAACAAACAGG - Intronic
949182691 3:1153849-1153871 CTGGGATCCTTGAGCAAAGCAGG - Intronic
961480493 3:127176389-127176411 CTGGTATCCTTAAGCTCACAGGG - Intergenic
962493049 3:135911954-135911976 CAGGGATCCTTGAGAAAAACAGG - Intergenic
965025501 3:163297057-163297079 CTGGGATGCTTGAGCTAGGCAGG + Intergenic
965806875 3:172551103-172551125 CTGGTTACCATGACCTAAACAGG + Intergenic
966504537 3:180684854-180684876 CTGGTTTCCATGAGCTCACCTGG + Intronic
967593497 3:191304332-191304354 CTGGTTTCCTTGATCTTCACTGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
973004451 4:44990654-44990676 CTGATAGCCTTGAGCTGAAGAGG + Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
979417460 4:120460947-120460969 CTGGGATCCTTGAGCTTGATAGG + Intergenic
981402897 4:144335141-144335163 CTGGGATCCTAGAGCTGGACAGG - Intergenic
983922439 4:173360289-173360311 CTGGGAGCCTTTAGCTACACTGG - Intergenic
984980197 4:185273148-185273170 TTGGTAACCTTCAGCTGAACTGG - Intronic
986092457 5:4523601-4523623 CAGGCATCCTTGAGAAAAACAGG + Intergenic
986532472 5:8753195-8753217 TTGGTATCCTTGAGATAACAGGG - Intergenic
986859546 5:11910911-11910933 CTGCTATTCTTGAGCTATTCTGG + Intergenic
990597379 5:57325059-57325081 CTGGGATGCTTGTGCTAACCAGG - Intergenic
992643604 5:78791945-78791967 CTGGCTTCCTTGAGCCACACTGG + Intronic
994147020 5:96406601-96406623 CAGGGATCCTAGAGATAAACTGG + Intronic
1000520228 5:162285673-162285695 CTGGTATATTTGAGCTAACATGG + Intergenic
1001822291 5:174719983-174720005 CGGATCTCCTAGAGCTAAACTGG - Intergenic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1003964760 6:11242259-11242281 CTGGTACCCCTGAGCTTTACAGG + Intronic
1004513095 6:16298324-16298346 GTGGTACTCTTGAGGTAAACGGG + Intergenic
1016688691 6:146910777-146910799 CTTGTCTCCTGTAGCTAAACCGG - Intergenic
1018615344 6:165681580-165681602 GTGGTAGCCTTGTGCTAGACCGG - Intronic
1020930415 7:14386235-14386257 CTGTTATCATGGAGCTGAACTGG - Intronic
1023618445 7:42045169-42045191 CTGGTATCCTTGAGCTAAACAGG + Intronic
1027346774 7:77268401-77268423 CTGGTATCCAGGAGCAGAACTGG - Intronic
1036035418 8:5013354-5013376 TTGATATCCTTGAGCTCAAGTGG - Intergenic
1036683229 8:10891383-10891405 CTGGGATCCTTGGGCTAGAGTGG - Intergenic
1046056064 8:109080607-109080629 CTGGTACCCCTGAGCTTAAAAGG + Intergenic
1047830923 8:128628627-128628649 TTGGTTTCCTTTAGCTAAAGTGG + Intergenic
1048559549 8:135518736-135518758 ATGGTATCAATGAGCTACACTGG - Intronic
1051702815 9:19842589-19842611 CTGGCAACTTTGAGCTATACTGG + Intergenic
1060241076 9:121903948-121903970 TTGGTATCCCTGAGCTGAGCTGG - Intronic
1061965142 9:134009435-134009457 CTGATATCCTTGAGCAAGTCAGG + Intergenic
1192119687 X:68443491-68443513 CTGTTCTTCTTAAGCTAAACAGG - Intergenic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1197484009 X:127024494-127024516 CTGGTATCCTTGAGAAGAATGGG - Intergenic