ID: 1023620429

View in Genome Browser
Species Human (GRCh38)
Location 7:42066400-42066422
Sequence ACTTAGGTTATTATTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 150}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023620429_1023620443 28 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620443 7:42066451-42066473 AAAGATGGGGAAAGGTGGGGAGG No data
1023620429_1023620441 24 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620441 7:42066447-42066469 GTTAAAAGATGGGGAAAGGTGGG 0: 1
1: 1
2: 0
3: 37
4: 369
1023620429_1023620438 15 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620438 7:42066438-42066460 TCTGTCTGGGTTAAAAGATGGGG No data
1023620429_1023620436 13 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620436 7:42066436-42066458 AGTCTGTCTGGGTTAAAAGATGG 0: 1
1: 0
2: 3
3: 24
4: 231
1023620429_1023620440 23 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620440 7:42066446-42066468 GGTTAAAAGATGGGGAAAGGTGG No data
1023620429_1023620439 20 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG No data
1023620429_1023620437 14 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620437 7:42066437-42066459 GTCTGTCTGGGTTAAAAGATGGG 0: 1
1: 0
2: 1
3: 14
4: 183
1023620429_1023620434 2 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620434 7:42066425-42066447 CTAAAAAGTCCAGTCTGTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 161
1023620429_1023620433 1 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620433 7:42066424-42066446 ACTAAAAAGTCCAGTCTGTCTGG No data
1023620429_1023620442 25 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620442 7:42066448-42066470 TTAAAAGATGGGGAAAGGTGGGG 0: 1
1: 0
2: 3
3: 64
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023620429 Original CRISPR ACTTAGGTTATTATTGGTGG TGG (reversed) Intronic
901355105 1:8639337-8639359 ATTTAGGTCAGGATTGGTGGAGG - Intronic
901920173 1:12530512-12530534 ACTTAAGTGACTATGGGTGGGGG - Intergenic
912856166 1:113170505-113170527 ATTTAGGTTCTTCTTTGTGGAGG - Intergenic
913366190 1:118041814-118041836 TCTTAGGTTCTGGTTGGTGGGGG + Exonic
914398602 1:147294176-147294198 AAATAGATTATGATTGGTGGAGG - Intronic
916261944 1:162851065-162851087 ATTTAGGTTATTATTGTTTATGG + Intronic
916925777 1:169519273-169519295 ACTTAGGTAATTATTAGCAGTGG - Intronic
918626940 1:186666804-186666826 ACATAGGTTTTTATTTTTGGGGG + Intergenic
921221803 1:212978814-212978836 ACTATGGTTATTCTTGGTGGCGG + Intronic
921812029 1:219526060-219526082 CCTTAGGTTTTGTTTGGTGGTGG + Intergenic
923661815 1:235963862-235963884 ACTTAGGTTTTTTTTGGTTTTGG - Intergenic
1064527801 10:16276285-16276307 ACCTATGTTTTTATTGGTTGTGG - Intergenic
1065191315 10:23211770-23211792 ACATAGGATATTTTTGGTGGGGG + Intronic
1066135537 10:32442049-32442071 ACTTAGGTATTTTGTGGTGGTGG + Intergenic
1067321077 10:45221722-45221744 ACTTAGGTTACCATTGGTTAAGG + Intergenic
1068127306 10:52856223-52856245 ACTTAGTTTAGTAATGGTGCTGG - Intergenic
1068762245 10:60725324-60725346 ACTTCTGTTATTAGTGGTGGAGG - Intronic
1070377410 10:75846727-75846749 GCTTTGGTTTTTGTTGGTGGTGG - Intronic
1070834379 10:79438699-79438721 GTCTAGGTTATTTTTGGTGGGGG + Intronic
1071937018 10:90543311-90543333 ACTAAGGTTCTTATTTTTGGCGG - Intergenic
1072005903 10:91246812-91246834 ACTTAGTATTTTATTGGAGGAGG + Intronic
1078412462 11:11137511-11137533 AATTCGGGTATTAGTGGTGGTGG - Intergenic
1078556491 11:12331089-12331111 ACTTAGACTCTTATTGGTTGAGG + Intronic
1085164221 11:74381910-74381932 TCCTAGGTTACCATTGGTGGGGG - Intronic
1087787042 11:102366668-102366690 GATTAGGTTAATAGTGGTGGAGG - Intronic
1089233584 11:117003064-117003086 ATTTTTGTTGTTATTGGTGGTGG - Intronic
1093772355 12:23032649-23032671 AATTTTGTTATTATTAGTGGTGG + Intergenic
1100394455 12:94172376-94172398 AGTCAGGTTTTTACTGGTGGTGG - Intronic
1102209673 12:111116822-111116844 ACATAAGCTATTATTGTTGGAGG - Intronic
1105466488 13:20646616-20646638 ACTTAAGATTTTATTGGTGTAGG - Intronic
1105478976 13:20755676-20755698 ATTTTGGTTCTTATTTGTGGAGG + Intronic
1111710134 13:91801570-91801592 ACTTATGTTTCTATTGTTGGTGG - Intronic
1111905640 13:94252606-94252628 ACTTTTGTTGTTGTTGGTGGTGG - Intronic
1112191524 13:97182754-97182776 ACGTAGATTTTTGTTGGTGGTGG + Intergenic
1113213495 13:108010907-108010929 ACTTTTGTTTTTGTTGGTGGTGG + Intergenic
1113926271 13:113943490-113943512 ACCCAGGTTCTTATTTGTGGAGG + Intergenic
1115436548 14:33381530-33381552 AGTTAGGTTGTTTTTGGTGGGGG + Intronic
1116157539 14:41226459-41226481 ACTTGTATTTTTATTGGTGGTGG + Intergenic
1116347916 14:43820077-43820099 ACTTAGGACATTATTGCTGAAGG + Intergenic
1120645663 14:87071156-87071178 TCTTATGTTCTCATTGGTGGTGG - Intergenic
1122908179 14:104812431-104812453 GCTTAGATTTTTATTGGGGGGGG + Intergenic
1128513841 15:68329761-68329783 TCTTAGGTCCTTGTTGGTGGTGG - Intronic
1131668078 15:94591174-94591196 ACTGAGGGTGTTATGGGTGGAGG + Intergenic
1132317424 15:100900197-100900219 ACTTCGGTAATTATTGATGTAGG - Intronic
1139841035 16:69880815-69880837 ACTTCTGTTGTTATTGGTGCTGG + Intronic
1140028110 16:71310536-71310558 ACTGAGGTTATTATTGGACCAGG - Intergenic
1144760566 17:17704748-17704770 GCTTGTGTTGTTATTGGTGGTGG + Intronic
1148236256 17:45971179-45971201 ACTAAGGACATTCTTGGTGGAGG + Intronic
1150088712 17:62300304-62300326 CCTTAGGTTAGTATTGGTAGCGG + Intergenic
1151868444 17:76820409-76820431 CCTTAGGTTATGAAGGGTGGGGG + Intergenic
1155040275 18:22059568-22059590 ATAAAGATTATTATTGGTGGGGG + Intergenic
1156597905 18:38569046-38569068 ACCTAGGTTATGATTTGTGTAGG - Intergenic
1157653823 18:49364813-49364835 AACTAGGTTTTTATTGTTGGAGG - Intronic
925964022 2:9046366-9046388 ACTTAGATAATTATTGGAGATGG - Intergenic
928327813 2:30333963-30333985 TCCAAGGTTATTGTTGGTGGCGG - Intergenic
928705944 2:33949912-33949934 ACTTTGTTTTTTGTTGGTGGTGG - Intergenic
929603227 2:43217951-43217973 GCTCAGGTTATTAGTGGTGCAGG + Intergenic
931087751 2:58852237-58852259 GCTAGGATTATTATTGGTGGTGG + Intergenic
932057960 2:68466556-68466578 GCTTTGGTTTGTATTGGTGGTGG - Intronic
933297099 2:80503249-80503271 TCATAGGATATTATTGCTGGAGG + Intronic
940228759 2:151427887-151427909 ACTTATTTTATTTTTGGTTGAGG - Intronic
940757302 2:157698402-157698424 ACTCTGGTTATTCTTGGTGAAGG - Intergenic
941410476 2:165150246-165150268 TCTTTGTTTATTATTGGTTGAGG - Intronic
944199655 2:197092268-197092290 ACTTAGGTAATTAATGCTGTAGG - Intronic
944365921 2:198919456-198919478 ACATTGGTTATTATGTGTGGTGG - Intergenic
944367438 2:198939783-198939805 ACTTAGGTTTTCATTTTTGGGGG - Intergenic
945531838 2:210964970-210964992 ACTGAGGTTATGATGAGTGGAGG + Intergenic
945883970 2:215355178-215355200 ACTCAAGTTAATCTTGGTGGAGG + Intergenic
1170829388 20:19826920-19826942 ATTTTTGTTATTGTTGGTGGTGG + Intergenic
1170942868 20:20863504-20863526 AATTGTGTTTTTATTGGTGGAGG + Intergenic
1174823434 20:53747127-53747149 TCTTAGGTTATTTTTGGTGGAGG + Intergenic
1176729546 21:10479235-10479257 TTCTAGGTTATTACTGGTGGAGG + Intergenic
1177911319 21:27036352-27036374 AAAAAGTTTATTATTGGTGGAGG + Intergenic
1178935306 21:36856715-36856737 AACTAGGTGATTATTGGTGGTGG - Intronic
1183451324 22:37897051-37897073 ACTTCAATTATTATTGGTGCTGG - Intergenic
949469524 3:4380022-4380044 ACTTAAGTGGCTATTGGTGGTGG + Intronic
949807994 3:7976518-7976540 TCCTAGGTTATTATGGGTGCAGG - Intergenic
950247217 3:11432056-11432078 AGTTAGTTTTTTATTGGAGGGGG + Intronic
951456646 3:22899960-22899982 AATTAAGTTAATAGTGGTGGTGG - Intergenic
952250385 3:31647866-31647888 ACTGTGGTTCTTCTTGGTGGAGG - Intergenic
952507652 3:34022021-34022043 CATTAGGTTTTTGTTGGTGGTGG + Intergenic
952649595 3:35709271-35709293 TCTTAGGATATGACTGGTGGGGG + Intronic
953407561 3:42666963-42666985 ACTTGGGCCATTGTTGGTGGGGG + Intergenic
956786384 3:72646114-72646136 CCTTATGTTGTTCTTGGTGGTGG - Intergenic
957290457 3:78271662-78271684 CATTAGGTGAGTATTGGTGGAGG - Intergenic
957319805 3:78615426-78615448 ACTTCTGTTTTTTTTGGTGGTGG + Intronic
957743749 3:84310069-84310091 ACTTATTTTTTTGTTGGTGGTGG + Intergenic
961105627 3:124238589-124238611 ACTTAGATGCATATTGGTGGGGG - Intronic
961334843 3:126167570-126167592 ACTGAGGATATTTTTGCTGGTGG - Intronic
962072428 3:132045397-132045419 TCTGAGGCTATTCTTGGTGGAGG + Intronic
965572934 3:170189782-170189804 ACTTAGGCTGATAATGGTGGAGG - Intergenic
967912426 3:194553309-194553331 ACTTAGATTAATAATGGTGCTGG + Intergenic
970384215 4:15540128-15540150 GCTTAGGTTTTTTTTGGGGGAGG - Intronic
971840111 4:31840241-31840263 ATTTAAATTATTTTTGGTGGAGG + Intergenic
972022371 4:34332031-34332053 ACTTATGTTATTATCTGTGTGGG + Intergenic
972218624 4:36926510-36926532 TATTTGGTTATTGTTGGTGGTGG + Intergenic
972448123 4:39166875-39166897 ACTTAGGTATTTATTTATGGAGG - Intergenic
973261859 4:48173299-48173321 GATTAGGTTTTTTTTGGTGGGGG - Intronic
973908094 4:55550726-55550748 ACTTTGGATATTATTGGTGGTGG - Intergenic
976447525 4:85148963-85148985 AGTTAGGTAGTTATTGGTGGTGG + Intergenic
979277172 4:118827438-118827460 TCTTAGATTTTTTTTGGTGGGGG - Intronic
981043426 4:140244084-140244106 TATCAGGTTGTTATTGGTGGTGG - Intergenic
981076847 4:140600963-140600985 ACTTAGGGGACTATTGGAGGAGG + Intergenic
981523718 4:145691539-145691561 ACTTAGGTGCTGATTAGTGGTGG + Intronic
982346276 4:154364072-154364094 CCTTGGGTTCTTATTGTTGGCGG - Intronic
982576381 4:157115486-157115508 ACATAAGGTATTATTGTTGGTGG - Intronic
983593745 4:169442284-169442306 TCTTAGGTTATGATTGTTAGTGG - Intronic
983642511 4:169956012-169956034 ACTCAGATTAGGATTGGTGGAGG - Intergenic
987548858 5:19352178-19352200 AGTTATGTTGTTATTGGTGTCGG + Intergenic
988028951 5:25738479-25738501 ATTTTGGTTCTTATTTGTGGAGG - Intergenic
991996734 5:72395088-72395110 TCTTAAGTTATTAATGGTGTGGG + Intergenic
993151870 5:84172793-84172815 ACTTAGCTTATCATTGTTGTTGG - Intronic
993476043 5:88365919-88365941 AATTTGGATATTATTGATGGCGG + Intergenic
995634469 5:114170426-114170448 ACTTTGGTTATGCTTTGTGGTGG + Intergenic
999739460 5:154539024-154539046 ACTAAGGGTATGAGTGGTGGAGG + Intergenic
1003156868 6:3604067-3604089 ATTTTGGTTTTTCTTGGTGGAGG + Intergenic
1003619876 6:7690465-7690487 CCATAGGTAATTAGTGGTGGAGG + Intergenic
1006975870 6:38100454-38100476 AAATAGGTTCTTATTGGTGTTGG + Intronic
1008296648 6:49786472-49786494 AATGAGATGATTATTGGTGGTGG - Exonic
1010422756 6:75692900-75692922 ACTTTGTTTTTTTTTGGTGGGGG - Intronic
1010945456 6:81969236-81969258 ACTTAGGTTTTCAGAGGTGGAGG - Intergenic
1012521297 6:100124414-100124436 GCTTAGATTATTAATGGTTGAGG + Intergenic
1013220797 6:108075208-108075230 CCGTTGGTTATTATAGGTGGTGG + Intronic
1014831597 6:126108991-126109013 AATTAGGATATTATAGTTGGAGG - Intergenic
1016808156 6:148234018-148234040 ACTTAGGTTTTTTTTGGGTGGGG + Intergenic
1017229859 6:152062355-152062377 ACACAGGTTACTAGTGGTGGTGG - Intronic
1017566634 6:155694055-155694077 ACTTAGATAAAAATTGGTGGTGG - Intergenic
1017697625 6:157033607-157033629 ATTTGTGTTATTTTTGGTGGAGG + Intronic
1023468146 7:40481525-40481547 CCTTAAGTTTTTATTGATGGTGG - Intronic
1023620429 7:42066400-42066422 ACTTAGGTTATTATTGGTGGTGG - Intronic
1028864538 7:95692499-95692521 ACTCAGGTTATCATTGGTTTGGG + Intergenic
1028900314 7:96092121-96092143 ACTTAGGAAATTATTTGTGTGGG + Intronic
1033810956 7:145010423-145010445 ACTCAGGTTGTTATTGATGCAGG + Intergenic
1034600041 7:152242342-152242364 TTCTAGGTTATTACTGGTGGAGG - Intronic
1037063686 8:14548689-14548711 AATTAGATTATAATTAGTGGGGG + Intronic
1041308500 8:56489309-56489331 ATTTATGTTGTTGTTGGTGGTGG + Intergenic
1042633129 8:70843486-70843508 ATTTAGGTTCTTCTTGGAGGAGG - Intergenic
1044185198 8:89242588-89242610 GCTTGGCTTATTATTGGTGTGGG - Intergenic
1047551141 8:125873465-125873487 TCCAAGGTTTTTATTGGTGGTGG + Intergenic
1051068513 9:13134557-13134579 ACTTTGGTGATTATCAGTGGGGG - Intronic
1053658904 9:40249790-40249812 ACTCAGGTGATTTTTGGTGCTGG + Intronic
1054371024 9:64396080-64396102 ACTCAGGTGATTTTTGGTGCTGG + Intronic
1054525694 9:66126432-66126454 ACTCAGGTGATTTTTGGTGCTGG - Intronic
1054678656 9:67885809-67885831 ACTCAGGTGATTTTTGGTGCTGG + Intronic
1056197149 9:84239798-84239820 ACTCATGTGATTATTGGTGTTGG + Intergenic
1203584722 Un_KI270746v1:54841-54863 TTCTAGGTTATTACTGGTGGAGG - Intergenic
1188349553 X:29111485-29111507 ACTTAAGTTCTTGTTGATGGTGG + Intronic
1190232417 X:48592570-48592592 AGTTTGGTTATTGTTGCTGGGGG - Intronic
1192083489 X:68071059-68071081 AATGAGATGATTATTGGTGGTGG - Intronic
1192395208 X:70773746-70773768 ATTTTGGTTCTTATTAGTGGAGG - Intronic
1193150834 X:78122887-78122909 AATGAGATGATTATTGGTGGTGG + Exonic
1193968528 X:88020594-88020616 AATTAAGTTATTATTATTGGGGG - Intergenic
1194079847 X:89447235-89447257 AGTTAGATAATTATTTGTGGTGG - Intergenic
1194245467 X:91506289-91506311 ACTTAGGTACTAATTAGTGGTGG + Intergenic
1194544693 X:95218833-95218855 ACTTTGGTTTTCCTTGGTGGAGG - Intergenic
1194684145 X:96891088-96891110 GCATAGGTTTTTATTGATGGTGG - Intronic
1199169167 X:144716473-144716495 AATTAGGATGTTAATGGTGGTGG - Intergenic
1199643219 X:149882612-149882634 ACTTTGGTTATTATCTCTGGGGG + Intronic
1200432467 Y:3102513-3102535 AGTTAGATAATTATTTGTGGTGG - Intergenic
1200779492 Y:7201557-7201579 ACATGAGTTATAATTGGTGGTGG - Intergenic