ID: 1023620430

View in Genome Browser
Species Human (GRCh38)
Location 7:42066403-42066425
Sequence GTTACTTAGGTTATTATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023620430_1023620442 22 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620442 7:42066448-42066470 TTAAAAGATGGGGAAAGGTGGGG 0: 1
1: 0
2: 3
3: 64
4: 825
1023620430_1023620440 20 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620440 7:42066446-42066468 GGTTAAAAGATGGGGAAAGGTGG No data
1023620430_1023620438 12 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620438 7:42066438-42066460 TCTGTCTGGGTTAAAAGATGGGG No data
1023620430_1023620437 11 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620437 7:42066437-42066459 GTCTGTCTGGGTTAAAAGATGGG 0: 1
1: 0
2: 1
3: 14
4: 183
1023620430_1023620436 10 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620436 7:42066436-42066458 AGTCTGTCTGGGTTAAAAGATGG 0: 1
1: 0
2: 3
3: 24
4: 231
1023620430_1023620441 21 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620441 7:42066447-42066469 GTTAAAAGATGGGGAAAGGTGGG 0: 1
1: 1
2: 0
3: 37
4: 369
1023620430_1023620439 17 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG No data
1023620430_1023620433 -2 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620433 7:42066424-42066446 ACTAAAAAGTCCAGTCTGTCTGG No data
1023620430_1023620443 25 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620443 7:42066451-42066473 AAAGATGGGGAAAGGTGGGGAGG No data
1023620430_1023620434 -1 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620434 7:42066425-42066447 CTAAAAAGTCCAGTCTGTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023620430 Original CRISPR GTTACTTAGGTTATTATTGG TGG (reversed) Intronic
903591297 1:24457874-24457896 GTTATTTTGGTTATTATTTTTGG + Intronic
910070039 1:83201923-83201945 GTTCTTTAGGTTATTATTTTTGG + Intergenic
910552311 1:88489405-88489427 GTTTCTTACCTTATTATTGTAGG - Intergenic
911586824 1:99700907-99700929 GTTACTTGGTTTTTTATTGTTGG + Intergenic
917205571 1:172567631-172567653 GATATTTAGGTTATTATTTTTGG + Intronic
917664514 1:177211700-177211722 TTTATTTGGGTTATTACTGGTGG + Intronic
918975964 1:191486861-191486883 GTTACTAATGTAATTTTTGGAGG - Intergenic
921560783 1:216655809-216655831 GTTACTTAGTTCATTGTTGTTGG + Intronic
922410669 1:225372049-225372071 GTTACATAGGTAATAAGTGGAGG + Intronic
923584654 1:235257249-235257271 GTTGCTTGGTTTATTTTTGGTGG - Intronic
1068762246 10:60725327-60725349 TTTACTTCTGTTATTAGTGGTGG - Intronic
1072005902 10:91246809-91246831 GCTACTTAGTATTTTATTGGAGG + Intronic
1074937919 10:118204460-118204482 GTTGCTTAGGCTATTATTAAAGG - Intergenic
1078299167 11:10108128-10108150 GTTACTTAGGTTATATTTGATGG - Intronic
1079421134 11:20289861-20289883 GTTAATGAGGTTACTATTGTTGG - Intergenic
1080067673 11:28038295-28038317 GTTACATATGTCATTATTTGGGG - Intronic
1082745586 11:56958072-56958094 ATTACTGAGGTTTTTTTTGGGGG + Intergenic
1084744293 11:71158357-71158379 TTGACTTTGGTTATTGTTGGTGG - Intronic
1085567924 11:77531551-77531573 TTTACTTAGTTTTTTATTGGGGG - Intronic
1089816540 11:121182029-121182051 GTGACTTAGGCTATTAATGGAGG + Intronic
1090131123 11:124143092-124143114 AATAATGAGGTTATTATTGGGGG - Intronic
1091177028 11:133569091-133569113 GTCACTTAGGTTGTGATTTGTGG + Intergenic
1096111215 12:49030425-49030447 GTTACTCAGGTTATTCTGAGGGG + Exonic
1096173759 12:49496992-49497014 CTTACTTAGCTTTTTACTGGTGG - Exonic
1096772785 12:53946836-53946858 GTTACTTCGGTTAATAATTGGGG + Intergenic
1111445554 13:88342797-88342819 GTTACATAGCTTATTATCAGAGG + Intergenic
1112244292 13:97716203-97716225 ATTAAATAGGTTATTATAGGTGG - Intergenic
1112527762 13:100168572-100168594 GTTACTTATGCTAGTATTGGGGG + Intronic
1113291883 13:108916177-108916199 GTCACTTAGGTTATTAATAATGG - Intronic
1113385701 13:109845893-109845915 GTTTCTTAGCTGATTAGTGGTGG + Intergenic
1118926451 14:70194377-70194399 TTTACCTAGTTTATCATTGGTGG + Intergenic
1120167768 14:81219976-81219998 GTTTCTTAGGTTGTTTTTGGCGG - Intronic
1122664978 14:103322988-103323010 GTCACTTAGGCTATTATTGTAGG + Intergenic
1125493688 15:40169430-40169452 GTTACTCAGCTTGTGATTGGTGG + Intronic
1125809565 15:42526136-42526158 GTTACTTCTGTTAATATTTGTGG + Intronic
1126912873 15:53433711-53433733 GTTGCTTAGATTTATATTGGAGG - Intergenic
1137459766 16:48649724-48649746 GTTTCTTAGGCCCTTATTGGGGG + Intergenic
1145392771 17:22468707-22468729 ATTAATTAGGATATTATTGTAGG + Intergenic
1155509868 18:26565857-26565879 GTTATTTTTGTTATTATTGTGGG + Intronic
1156579793 18:38361778-38361800 GTTACTGTTGTTATTATTTGGGG - Intergenic
1167348553 19:48961726-48961748 CTTACTTTTGTAATTATTGGGGG + Exonic
925053443 2:835194-835216 GTTATTTTGTTTATTATTGCGGG - Intergenic
931508074 2:62954229-62954251 GTTACATTGCTTATTATTAGTGG + Intronic
938218206 2:129541235-129541257 GATAATTAGGTTATTGTTTGGGG - Intergenic
938634565 2:133209500-133209522 ATTACTTAGGTAACTACTGGTGG + Intronic
941485931 2:166082288-166082310 GTTACGCAGCTTATTAATGGTGG + Intronic
941646220 2:168044551-168044573 GTTTCTTAGATAATTATTAGAGG - Intronic
941828355 2:169925286-169925308 GTTACTTAGGGTTTTCTTGAGGG + Intronic
944706890 2:202298777-202298799 GGTATTTGGGTTATTATTTGAGG + Intronic
945932377 2:215867832-215867854 TTTCCTTAGGTTATTATTTTTGG - Intergenic
1170501383 20:16977950-16977972 GTTACTTAGTTTGGTATTGTTGG + Intergenic
1174823433 20:53747124-53747146 AATTCTTAGGTTATTTTTGGTGG + Intergenic
1178935307 21:36856718-36856740 CTTAACTAGGTGATTATTGGTGG - Intronic
1184532871 22:45067780-45067802 GTTACATAGGTTTTTTTTTGTGG - Intergenic
963856717 3:150261713-150261735 GTTGCTTAGGTAATATTTGGAGG - Intergenic
964603583 3:158532138-158532160 GTTACTTATGTTACTATTCCAGG - Intronic
965190898 3:165528218-165528240 GTAACTTAAGTCATTACTGGTGG - Intergenic
967678871 3:192335635-192335657 GTTACATAGGTAATTAATGCTGG - Intronic
971456454 4:26849925-26849947 TGTACTTAGATTACTATTGGCGG + Intergenic
972510874 4:39767995-39768017 GTTCCTTATGTTATTTTTGGTGG + Intronic
972958566 4:44422913-44422935 GTTACTGATGTTGTTGTTGGTGG + Intronic
973671878 4:53228014-53228036 GTTACATAGTTTATAAGTGGTGG - Intronic
973908095 4:55550729-55550751 ATAACTTTGGATATTATTGGTGG - Intergenic
975234399 4:71975016-71975038 GTTATTTAGTTTATTATTTGTGG - Intergenic
975861533 4:78682398-78682420 GTTAGTATGGTTAGTATTGGTGG + Intergenic
976447524 4:85148960-85148982 GTAAGTTAGGTAGTTATTGGTGG + Intergenic
978557705 4:109998530-109998552 TTTACTTATTTTATTTTTGGTGG - Intronic
979341037 4:119524528-119524550 GTCATTTATGGTATTATTGGAGG - Intronic
980806063 4:137815232-137815254 GTTACTTTATTTATTATTGTTGG - Intergenic
982090610 4:151876945-151876967 GTTACTCTGGTTAATATTTGTGG - Intergenic
983122960 4:163911353-163911375 CTTACTAAGCTTATTATTGCAGG - Intronic
986039836 5:3982728-3982750 ATTCCTTACGTTATTTTTGGGGG + Intergenic
986616607 5:9623826-9623848 GTCACTTAGCTCATTAGTGGTGG + Intergenic
986990777 5:13550513-13550535 GGGACTTAGGTTCTTATGGGGGG - Intergenic
987188465 5:15449432-15449454 ATTATTTAGGTTATCATTGTAGG - Intergenic
987199715 5:15563785-15563807 GGTACTTAGGGAATTATTTGGGG + Intronic
987775174 5:22356233-22356255 GTTTCATAGGTTGTTATTTGGGG - Intronic
988274396 5:29062455-29062477 GTTACTAAGGTAATTGTTTGGGG + Intergenic
991981082 5:72231329-72231351 ATTTCTTAGGTTACTATTGAAGG - Intronic
993045839 5:82865648-82865670 TTTCCTTAGGATTTTATTGGTGG + Intergenic
995072038 5:107934667-107934689 GTTCCTTAAGTCCTTATTGGGGG + Intronic
998474760 5:142411298-142411320 GTTATTTAAGATATCATTGGGGG - Intergenic
1003619874 6:7690462-7690484 GTTCCATAGGTAATTAGTGGTGG + Intergenic
1005286672 6:24335188-24335210 GTTACTTGTGATATTATTGTAGG - Intronic
1006631972 6:35436458-35436480 GATGTTTAGGTAATTATTGGAGG - Intergenic
1009705836 6:67251100-67251122 AATACTTAGGTTATTAGTGAGGG - Intergenic
1013211069 6:107987235-107987257 TTTACTTTTCTTATTATTGGTGG - Intergenic
1018563037 6:165121831-165121853 GTTGCTCAGGTTACCATTGGAGG + Intergenic
1021809577 7:24390350-24390372 GTTAAGTAGGTCATTATAGGTGG - Intergenic
1022836845 7:34126045-34126067 GTTTATTTGGTTATTTTTGGTGG - Intronic
1023620430 7:42066403-42066425 GTTACTTAGGTTATTATTGGTGG - Intronic
1024033695 7:45488008-45488030 GTTACGTATTTTATTATTGCAGG + Intergenic
1027287812 7:76667085-76667107 GTTCTTTAGGTTATTATTTTTGG + Intergenic
1027470968 7:78573779-78573801 GTGAGTTGGGTTTTTATTGGAGG + Intronic
1027685046 7:81268948-81268970 GTTTCTTTGGTTGTTATTGGTGG - Intergenic
1028662496 7:93295888-93295910 TTTTCTTAAATTATTATTGGTGG + Intronic
1030886838 7:114949226-114949248 ATTATTTGGGTCATTATTGGGGG + Intronic
1033851202 7:145497712-145497734 GTTACATAGTTGATTAGTGGAGG + Intergenic
1034024250 7:147681391-147681413 GTTCCTCAGGTTAATATTTGGGG - Intronic
1039003071 8:33003238-33003260 ATAACTTAGGTTACCATTGGGGG - Intergenic
1043729288 8:83653872-83653894 GTTACTTAGTTTATTTGTGGTGG - Intergenic
1043783963 8:84373314-84373336 GTTACCTAGGTCATCATTGAGGG + Intronic
1044342481 8:91062904-91062926 GTTTCTTAGGTCTTTATTGTGGG - Intergenic
1046872486 8:119218929-119218951 GTTATGTAGGTTATTCTTTGTGG + Intronic
1048192679 8:132304399-132304421 ATTACAATGGTTATTATTGGTGG - Intronic
1048238824 8:132720315-132720337 GTTTCTTAGGTTAATGTTTGTGG - Intronic
1050867769 9:10525256-10525278 GTTTCTAATGTTATTATTGCAGG - Intronic
1053180103 9:35961378-35961400 TTTACTTAGGCACTTATTGGTGG - Intergenic
1059640020 9:116207302-116207324 CTTACTTATAATATTATTGGGGG + Intronic
1062742036 9:138180600-138180622 GTTACTTTTGTTTTTTTTGGGGG + Intergenic
1186499604 X:10040758-10040780 TTTAATTAGGTGATTCTTGGTGG - Intronic
1190428222 X:50352523-50352545 GTTACTTAAGTTGTTAATGGAGG + Intergenic
1194203416 X:90982988-90983010 TTTAATTTGTTTATTATTGGTGG - Intergenic
1196389647 X:115193838-115193860 GTTACTCAGGTAGTTTTTGGGGG - Intronic
1200549249 Y:4558422-4558444 TTTAATTTGTTTATTATTGGTGG - Intergenic
1201147953 Y:11076029-11076051 TTGACTTTGGTTATTGTTGGTGG - Intergenic