ID: 1023620431

View in Genome Browser
Species Human (GRCh38)
Location 7:42066406-42066428
Sequence TTAGTTACTTAGGTTATTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 208}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023620431_1023620436 7 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620436 7:42066436-42066458 AGTCTGTCTGGGTTAAAAGATGG 0: 1
1: 0
2: 3
3: 24
4: 231
1023620431_1023620442 19 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620442 7:42066448-42066470 TTAAAAGATGGGGAAAGGTGGGG 0: 1
1: 0
2: 3
3: 64
4: 825
1023620431_1023620438 9 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620438 7:42066438-42066460 TCTGTCTGGGTTAAAAGATGGGG No data
1023620431_1023620437 8 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620437 7:42066437-42066459 GTCTGTCTGGGTTAAAAGATGGG 0: 1
1: 0
2: 1
3: 14
4: 183
1023620431_1023620441 18 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620441 7:42066447-42066469 GTTAAAAGATGGGGAAAGGTGGG 0: 1
1: 1
2: 0
3: 37
4: 369
1023620431_1023620439 14 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG No data
1023620431_1023620440 17 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620440 7:42066446-42066468 GGTTAAAAGATGGGGAAAGGTGG No data
1023620431_1023620433 -5 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620433 7:42066424-42066446 ACTAAAAAGTCCAGTCTGTCTGG No data
1023620431_1023620434 -4 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620434 7:42066425-42066447 CTAAAAAGTCCAGTCTGTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 161
1023620431_1023620443 22 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620443 7:42066451-42066473 AAAGATGGGGAAAGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023620431 Original CRISPR TTAGTTACTTAGGTTATTAT TGG (reversed) Intronic
902885481 1:19401803-19401825 TCACTTTCTTATGTTATTATAGG - Intronic
908314814 1:62922342-62922364 TTGGGTACAGAGGTTATTATAGG - Intergenic
909123219 1:71631258-71631280 TTAATTACTTAAAATATTATAGG + Intronic
909313396 1:74183833-74183855 TTAGATATTTAAGTTATTTTGGG - Intronic
911192188 1:94959246-94959268 TAAGTTACCTAGATTATTACAGG - Intergenic
912771374 1:112466807-112466829 TTGCTTACTTGGCTTATTATGGG - Intronic
918131206 1:181631180-181631202 TCAGTTAATTAGGTAACTATAGG + Intronic
919037864 1:192339357-192339379 GTAGTTTCTTAGGTTAATAGTGG + Intronic
919532000 1:198733547-198733569 TTAGTTACTGAGGTGAATTTAGG + Intronic
921934772 1:220786637-220786659 TTATTTACTTACGTATTTATGGG - Intergenic
1063760530 10:9069927-9069949 TTAGTCACTTAAATTATTCTTGG - Intergenic
1064054273 10:12084220-12084242 TTAATAACTTGGGTCATTATTGG - Intronic
1064832596 10:19488035-19488057 TTTGTTACATAGGTGATTATAGG - Intronic
1064858638 10:19799504-19799526 TTAGTTACTTACTTTATTTTAGG - Intergenic
1065393418 10:25208142-25208164 TTAGTCACATGGCTTATTATTGG + Intronic
1066133138 10:32414234-32414256 ATATTTACTTAAGTTATTAAAGG + Intergenic
1066735311 10:38471734-38471756 TTAGGGCCTTATGTTATTATTGG + Intergenic
1067109006 10:43385559-43385581 TTTGTTAATTAGGTTATGACAGG - Intergenic
1067321076 10:45221716-45221738 GTGGTTACTTAGGTTACCATTGG + Intergenic
1067480280 10:46591357-46591379 TTATTTACTTATTTTATTTTTGG - Intronic
1067614457 10:47750443-47750465 TTATTTACTTATTTTATTTTTGG + Intergenic
1068248380 10:54404030-54404052 TGAATTACTTTGGATATTATAGG - Intronic
1068506788 10:57910445-57910467 GTACTTCCTTGGGTTATTATTGG - Intergenic
1071629863 10:87210414-87210436 TTATTTACTTATTTTATTTTTGG + Intergenic
1071765207 10:88656219-88656241 TTAATTATTTATGTTACTATTGG - Intergenic
1072160149 10:92758701-92758723 TTATTTACTCAGTTTCTTATTGG + Intergenic
1074172568 10:110957592-110957614 TTAGTTTCTTAGATAATTAGAGG - Intronic
1074475136 10:113766264-113766286 TTGTTTTCTTGGGTTATTATAGG + Intronic
1074603677 10:114939421-114939443 CTAGTTAGTTAGGTTATTCAAGG + Intronic
1074904404 10:117848360-117848382 TCAGTTAATTTGGATATTATAGG + Intergenic
1079416431 11:20241320-20241342 TAAGTTAATAATGTTATTATAGG + Intergenic
1080629719 11:34062766-34062788 TTAACTACTTTGGTTATTTTAGG + Intronic
1080675143 11:34419203-34419225 TTATTTACTTTTGTTTTTATAGG - Intergenic
1080930664 11:36806615-36806637 TTAGTTGCTTTGGGGATTATGGG + Intergenic
1080935669 11:36860645-36860667 TTATTTATTTCAGTTATTATAGG - Intergenic
1084983782 11:72849458-72849480 TTATTTATTTAGGTGGTTATGGG + Intronic
1085567927 11:77531554-77531576 CTATTTACTTAGTTTTTTATTGG - Intronic
1086011747 11:82112758-82112780 TGATTTTCTTAGGTTATTTTAGG - Intergenic
1087484473 11:98744331-98744353 TTACTTAGTTAGTTTCTTATGGG + Intergenic
1087991787 11:104752568-104752590 TTAATTTCTTAGGTAGTTATGGG + Intergenic
1088155988 11:106804457-106804479 TTAGGTACTTAGGTTATTGTTGG - Intronic
1088351084 11:108888429-108888451 TTACTTACTTAGATCATCATTGG - Intronic
1089816539 11:121182026-121182048 TCAGTGACTTAGGCTATTAATGG + Intronic
1089911827 11:122108557-122108579 TTAGTATCTTAGGATATTAGGGG + Intergenic
1091274233 11:134339268-134339290 TGAGTTACTCAGGAAATTATGGG + Intronic
1093562838 12:20562714-20562736 TTAGTTATTTAGTATATTATTGG + Intronic
1094805841 12:34090672-34090694 TTAGTTACTGAGATTAGTAGAGG + Intergenic
1095124518 12:38460658-38460680 TTAGTTACTGAGATTAGTAGAGG + Intergenic
1096159157 12:49362611-49362633 TTAGGTACTAGGGTTAGTATAGG + Intergenic
1098538969 12:71629935-71629957 TTAATTACTTAGTTCATTTTAGG - Intronic
1099723359 12:86392962-86392984 TTGTTTTCTTAGTTTATTATAGG - Intronic
1100101439 12:91111065-91111087 TTAGTTATATATGTTAGTATTGG - Intronic
1103694615 12:122804616-122804638 TTATTTATTTTTGTTATTATTGG - Intronic
1104303073 12:127583254-127583276 TTAATCACTGAGTTTATTATAGG + Intergenic
1106449079 13:29863652-29863674 TTAGTTTGGAAGGTTATTATTGG - Intergenic
1106784592 13:33093948-33093970 TTATTTATTTAGGTTTTTTTTGG + Intergenic
1108097496 13:46918974-46918996 TTGGTTATTTGGGTTATTTTTGG + Intergenic
1108924226 13:55718883-55718905 TTATTTATTGAGGTGATTATAGG + Intergenic
1109443371 13:62402282-62402304 TTGGTTATTTAGGTTATTCCAGG - Intergenic
1109979854 13:69893821-69893843 TTATTTACTTATGTGTTTATAGG + Intronic
1110087548 13:71400667-71400689 TTAGTTACTGAAATTATTTTTGG + Intergenic
1110156149 13:72319332-72319354 TTATTTATTTTGGTAATTATTGG + Intergenic
1110583281 13:77157902-77157924 TAAGTTACTTACTTTATTTTAGG - Intronic
1111223113 13:85231567-85231589 CTAATTACTTAGTTAATTATAGG + Intergenic
1116586555 14:46712243-46712265 TTAGTTACTGAGTTAAATATGGG + Intergenic
1119202101 14:72763281-72763303 TTAGTTATTTTGATTATTCTAGG - Intronic
1123634732 15:22292785-22292807 TTTGTTAATTTGGTTTTTATAGG + Intergenic
1123851969 15:24366894-24366916 TTAGTTGCTTAGTATATTGTGGG - Intergenic
1124227680 15:27908756-27908778 TTAGAGACTCAGGTTTTTATTGG + Intronic
1124932855 15:34139137-34139159 TTAGTTACTTAAGTTAGTCAAGG - Intergenic
1125336574 15:38632341-38632363 TTAGGTGCTTATGGTATTATAGG - Intergenic
1126485597 15:49176688-49176710 TTGGTCACATAGGTTATTTTAGG + Intronic
1129082717 15:73054282-73054304 TTAGTTACTTACAAAATTATCGG - Intronic
1131715625 15:95107679-95107701 TTAATATCTTAGATTATTATGGG + Intergenic
1140028112 16:71310542-71310564 TTCCTAACTGAGGTTATTATTGG - Intergenic
1142528584 17:563128-563150 TTAGTTTCTTACTTTAGTATTGG - Intronic
1144352256 17:14408406-14408428 TTGCTTACTTAGGTTATTTTTGG + Intergenic
1144735098 17:17551123-17551145 TTAATTACTGTTGTTATTATGGG + Intronic
1149156509 17:53636592-53636614 TTATTTACTTATGTAATTTTTGG - Intergenic
1153521312 18:5956816-5956838 TTATTTACTTCTGATATTATTGG - Intronic
1155097654 18:22574348-22574370 TTGGTTACTAAGTTTAATATTGG + Intergenic
1155943183 18:31820298-31820320 TTATTTACTTAGTTTACTCTGGG + Intergenic
1155950622 18:31908191-31908213 TTAATTTCTTAGTTTCTTATTGG - Intronic
1156247230 18:35312953-35312975 TTAGTTAATTTGGGGATTATAGG - Intergenic
1157737539 18:50063365-50063387 TTAGTTACTTAGGTGGCTCTGGG - Intronic
1158145080 18:54303220-54303242 TTAGGTACTTAGGGCATTGTTGG - Intronic
1159055578 18:63459979-63460001 TTAGTTATATAGGACATTATTGG - Intergenic
1160371861 18:78378886-78378908 TTAGAAACTTAAGGTATTATGGG + Intergenic
1161024480 19:2029530-2029552 TTTGTTACTTAGTTTGTTACAGG + Intronic
1163036896 19:14575047-14575069 TTATTTATTTTGTTTATTATTGG + Intergenic
1165702130 19:37946466-37946488 TTAGTTACTTTGGTAACTTTTGG - Intronic
1166810531 19:45511722-45511744 GTAGTGAGTTAGGTTTTTATAGG + Intronic
926064733 2:9829413-9829435 TTAGTTACTTTTCTTATTTTGGG + Intergenic
926463319 2:13160939-13160961 ACAGTTAATTAGGTTATTAAGGG - Intergenic
927041148 2:19231652-19231674 CTAGTTAATTAGGTCATTAGAGG - Intergenic
927265474 2:21144282-21144304 TTAGTTACTGAGGATTTTGTAGG + Intergenic
927970410 2:27302467-27302489 TTATTTACTTATTTTATTTTAGG - Intronic
928591553 2:32821561-32821583 TTGTTTAATTAGGGTATTATGGG + Intergenic
928787726 2:34909877-34909899 TTTGTTTCTTAAGTTATTTTGGG - Intergenic
929890564 2:45915509-45915531 TTAGAGATTTAGGTTATTTTGGG + Intronic
931706864 2:64953556-64953578 TTAGTTACTGATCTTATTGTTGG + Intergenic
938870939 2:135475678-135475700 TTATTTCATTAGGTTATTTTGGG + Intronic
939756632 2:146121074-146121096 TGAGTTACTAAGGTTATTGAAGG + Intergenic
939908062 2:147943221-147943243 TTAGATAATTAAGTTTTTATGGG - Intronic
940255437 2:151723561-151723583 TTGGTTCTTTAGGTTATTAATGG - Intronic
940532210 2:154892340-154892362 TTAGTTTCTTAGGGTACCATGGG - Intergenic
940973130 2:159915344-159915366 TTAGCTATTAAGGTTAGTATTGG + Intergenic
941504116 2:166319098-166319120 TTAGTTAGTTATCTTATTTTTGG - Intronic
941610132 2:167651441-167651463 TTAGTGACTCAGGTTATAAGAGG - Intergenic
942880519 2:180855420-180855442 ATATTGAATTAGGTTATTATTGG - Intergenic
944108126 2:196101517-196101539 TTAGTGAAATAGGTTATTTTGGG + Intergenic
944220272 2:197296515-197296537 TTAGTTTCTTAGGTGAGTGTTGG - Intronic
945433534 2:209793574-209793596 ATAGTTAATTATGATATTATGGG - Intronic
1168769564 20:406955-406977 TTACTTATTTATGTTATTCTGGG - Intergenic
1169033172 20:2429166-2429188 TTAGTTCAGTAGGTCATTATTGG - Intronic
1170254634 20:14326649-14326671 TAAATTACTTAGGTTATTATTGG + Exonic
1170534480 20:17326363-17326385 ATAGTTCCTTAGGTTCTTCTTGG - Intronic
1170751633 20:19153601-19153623 TTTGGTATTAAGGTTATTATTGG + Intergenic
1172797128 20:37548044-37548066 TTAATTACTCTGGTTATTTTAGG - Intergenic
1177301309 21:19249127-19249149 TTATTTCCATAGGTTATTAGGGG + Intergenic
1177883647 21:26722781-26722803 TTACTTATTTAGGGTAATATTGG + Intergenic
1178159627 21:29896753-29896775 TTAGCTACTTGGGTCACTATTGG + Intronic
1178450520 21:32695015-32695037 TTACTTAATTAATTTATTATAGG - Intronic
950592576 3:13949021-13949043 TTAGTTATTTGGGTTATTCTGGG + Intronic
951271144 3:20625983-20626005 TTAATTACTTTGCTTGTTATTGG - Intergenic
951719580 3:25683795-25683817 TGAGTTACTTGTTTTATTATTGG - Intergenic
952875994 3:37944983-37945005 TTAGTTAGTTAGTTAGTTATGGG + Intronic
953511194 3:43541153-43541175 TTAGTAACTTAGTTTGTTGTGGG + Intronic
957563065 3:81849226-81849248 TTAGTAACTCAGGAGATTATAGG + Intergenic
959654280 3:108783433-108783455 ATTTTTAATTAGGTTATTATGGG + Intergenic
960460385 3:117927283-117927305 ATTGATACTTAGGTTATTGTTGG + Intergenic
960489393 3:118295118-118295140 TAAGTTTCTTATGTTAATATTGG + Intergenic
964273766 3:154986950-154986972 CTAGTTACCTAGTTTCTTATTGG - Intergenic
965037560 3:163461021-163461043 TCAGTTTCTTAGGTTCATATAGG - Intergenic
965162217 3:165148931-165148953 TTAGCTACTTATGTTTATATAGG + Intergenic
967647713 3:191946699-191946721 TTAGTTTCTGAGTTTATAATAGG - Intergenic
967724996 3:192853460-192853482 TTTGTTACTTAGGTACTTAGGGG - Intronic
970658066 4:18253902-18253924 TTAAGGACTTAGGTAATTATAGG + Intergenic
972463688 4:39331044-39331066 TTAGTTACTAGGACTATTATGGG - Intronic
973024504 4:45250555-45250577 ATTATTACTTAGGGTATTATTGG + Intergenic
975213464 4:71727932-71727954 TTAGTTTCTTAAGTTATTGCTGG + Intergenic
975414356 4:74090352-74090374 TTGGTTATTTGGGTTATTCTGGG - Intergenic
978691378 4:111515771-111515793 TTAGTTATTACTGTTATTATTGG + Intergenic
978789648 4:112647605-112647627 TTAATTAATTAGGTTTTAATTGG + Intronic
979433634 4:120662781-120662803 TTTGTTACATAGGTAAATATGGG + Intergenic
979880052 4:125944103-125944125 TTAGTTATTTAGGCTAATAATGG - Intergenic
980150450 4:129041072-129041094 TTATGTACTTTGGTTGTTATAGG - Intronic
980464668 4:133156787-133156809 TTCTTCAGTTAGGTTATTATGGG - Intronic
980730699 4:136821378-136821400 TGATTTACTTAAGTTAATATTGG - Intergenic
981098279 4:140804013-140804035 TTACCTATTTAGTTTATTATTGG - Intergenic
983793656 4:171830798-171830820 TTTGTTATTTATGTTATCATTGG - Intronic
986895426 5:12360450-12360472 GTAGTTACATAAATTATTATTGG - Intergenic
987984704 5:25132169-25132191 TTATTTATTTAGGTAATTATGGG + Intergenic
989319237 5:40115867-40115889 TTATTTACTTAGTTTATTACAGG - Intergenic
990086134 5:51980022-51980044 TTAGTTAGTTAGTGAATTATTGG + Intergenic
992862944 5:80930412-80930434 GTAGTTATTCAGGTTATTACAGG - Intergenic
994635509 5:102340714-102340736 TTGGTTATTTGGGTTATTCTGGG + Intergenic
994736204 5:103559603-103559625 TTTGTTACATAGTTTACTATTGG + Intronic
996922061 5:128779865-128779887 ATATTTACTTAGGTTTTTGTTGG + Intronic
997880586 5:137585971-137585993 TTAGTTACTTAGCATAGAATTGG - Intronic
1002892396 6:1346856-1346878 TTAGTTACTTAGGATGTCAGAGG - Intergenic
1004863257 6:19828283-19828305 ATAGTTACAGAGGTTATTTTTGG + Intergenic
1005108959 6:22257454-22257476 TCATTTATTTAGGTTATTGTAGG + Intergenic
1005641840 6:27803498-27803520 TTTGTTAATTAGGATTTTATAGG - Intergenic
1008443669 6:51562193-51562215 TTAGTTAATTCTGTTTTTATTGG - Intergenic
1008449787 6:51637168-51637190 TTAATTACTGAGGTAATTAAAGG + Intronic
1009503526 6:64447398-64447420 TTATTTACTTAGTATATGATAGG + Intronic
1009958741 6:70492468-70492490 TTTGTCCCTTAGGTTTTTATTGG - Intronic
1010132356 6:72509167-72509189 TTTATTACTTAAGATATTATGGG - Intergenic
1011029351 6:82904783-82904805 TTTGTTACTTAGGGTAACATAGG - Intronic
1012123989 6:95403505-95403527 TTACATACTTAGGTTAAAATAGG + Intergenic
1014618369 6:123633326-123633348 TTGGTCAATTAGGTTGTTATTGG - Intronic
1014634614 6:123829810-123829832 TTAGTTACTTTGCTTATTTTGGG - Intronic
1014879523 6:126705824-126705846 TTAGCTAGTTAGGTTTGTATTGG - Intergenic
1016475721 6:144425030-144425052 TTTGCTACTAAGGATATTATTGG - Intronic
1017265249 6:152437680-152437702 TTCTTCACTTAGGTTATTACTGG - Intronic
1020869160 7:13606372-13606394 TTAGTTACCTAGATTCTTTTGGG - Intergenic
1021809578 7:24390353-24390375 TGAGTTAAGTAGGTCATTATAGG - Intergenic
1023592242 7:41792551-41792573 TTATCTACTTAGGATATTTTAGG - Intergenic
1023620431 7:42066406-42066428 TTAGTTACTTAGGTTATTATTGG - Intronic
1028127742 7:87133595-87133617 TTAGTTAGTTATTTTGTTATGGG - Intergenic
1028176307 7:87663674-87663696 TCAGAGAATTAGGTTATTATTGG - Intronic
1028271163 7:88791535-88791557 TTAGTGAATTAGGTTTCTATTGG + Intronic
1028864536 7:95692493-95692515 ATAATTACTCAGGTTATCATTGG + Intergenic
1031246435 7:119318839-119318861 TCAGTTACTTAGGGTACTAGTGG - Intergenic
1033028189 7:137798167-137798189 TCAGTCTCTTTGGTTATTATAGG - Intronic
1033464048 7:141574932-141574954 TAGGTTATTTAGGTTATTTTAGG + Intronic
1035485568 7:159221721-159221743 TTTATTACTTGGGTTATCATAGG + Intergenic
1035997345 8:4562862-4562884 TTACTTACTAAGGTTTTTGTGGG - Intronic
1037253605 8:16925890-16925912 TCAGTTACTTATGTTTTTCTTGG + Intergenic
1043729289 8:83653875-83653897 TTAGTTACTTAGTTTATTTGTGG - Intergenic
1045529552 8:102971639-102971661 TTTGTTAGTTACATTATTATTGG + Intronic
1046393323 8:113605804-113605826 TTATCTTCTTGGGTTATTATAGG + Intronic
1046807513 8:118496240-118496262 TTATCTACTTAGGCCATTATGGG - Intronic
1047739849 8:127797603-127797625 TTAGTTCCTTAGATTATTTGAGG - Intergenic
1051157620 9:14168187-14168209 TTATTTATTTAGTCTATTATTGG + Intronic
1051793288 9:20833390-20833412 TTATTTTCTTTGATTATTATAGG + Intronic
1054914469 9:70483183-70483205 TTATTTATTTTGGTTATTCTTGG + Intergenic
1055043124 9:71897144-71897166 TTAGTTTTATAGGTTATTCTTGG - Intronic
1056083998 9:83126858-83126880 TAAGTTACTAGGGCTATTATGGG + Intergenic
1057537525 9:95927726-95927748 TTAGTTTCTTAGCATATTGTAGG + Intronic
1058500401 9:105609509-105609531 TTTATTACAAAGGTTATTATTGG - Intronic
1059860482 9:118455148-118455170 TTAGTTATTATGGTTACTATCGG - Intergenic
1061525542 9:131158466-131158488 TTAGCTATTTAACTTATTATAGG - Intronic
1186309004 X:8297065-8297087 TTAGTTAGTTATCTTATTCTGGG - Intergenic
1188052463 X:25504442-25504464 TATATTACTTAGGTTTTTATTGG - Intergenic
1188827908 X:34859131-34859153 ATAATTATTTAGGTTATAATAGG - Intergenic
1189967124 X:46386424-46386446 TTAGGTACTTATGTGATTGTTGG - Intergenic
1191973518 X:66844020-66844042 TAAATTACTTTGGGTATTATGGG - Intergenic
1194176654 X:90658021-90658043 TTATTCACCTAGATTATTATTGG + Intergenic
1194292979 X:92098205-92098227 TTGGTTACTTAGATTAGTGTAGG - Intronic
1195030135 X:100919126-100919148 CAAATTACTTAGGTTATTTTGGG - Intronic
1196493063 X:116291251-116291273 TTGGTTATTTGGGTTATTCTGGG - Intergenic
1196917420 X:120551776-120551798 TAAGTTACTTATGTTCTAATAGG - Intronic
1197321343 X:125034961-125034983 TTAGTTATTTAGTATATTTTGGG - Intergenic
1197559790 X:128004997-128005019 TTAGTTAGTTAAATAATTATAGG + Intergenic
1198303990 X:135362022-135362044 TTAGTTCTGTAGCTTATTATTGG - Exonic
1199379815 X:147157168-147157190 TTAGTTTCATAGCTTGTTATTGG - Intergenic
1200523279 Y:4238892-4238914 TTATTCACCTAGATTATTATTGG + Intergenic
1200610485 Y:5322756-5322778 TTGGTTACTTAGATTAGTGTAGG - Intronic