ID: 1023620432

View in Genome Browser
Species Human (GRCh38)
Location 7:42066416-42066438
Sequence ACTGGACTTTTTAGTTACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 198}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023620432_1023620441 8 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620441 7:42066447-42066469 GTTAAAAGATGGGGAAAGGTGGG 0: 1
1: 1
2: 0
3: 37
4: 369
1023620432_1023620442 9 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620442 7:42066448-42066470 TTAAAAGATGGGGAAAGGTGGGG 0: 1
1: 0
2: 3
3: 64
4: 825
1023620432_1023620443 12 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620443 7:42066451-42066473 AAAGATGGGGAAAGGTGGGGAGG No data
1023620432_1023620438 -1 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620438 7:42066438-42066460 TCTGTCTGGGTTAAAAGATGGGG No data
1023620432_1023620439 4 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG No data
1023620432_1023620436 -3 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620436 7:42066436-42066458 AGTCTGTCTGGGTTAAAAGATGG 0: 1
1: 0
2: 3
3: 24
4: 231
1023620432_1023620437 -2 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620437 7:42066437-42066459 GTCTGTCTGGGTTAAAAGATGGG 0: 1
1: 0
2: 1
3: 14
4: 183
1023620432_1023620440 7 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620440 7:42066446-42066468 GGTTAAAAGATGGGGAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023620432 Original CRISPR ACTGGACTTTTTAGTTACTT AGG (reversed) Intronic
904545637 1:31268874-31268896 CCTGGCCTTTTTAATTACTTGGG - Intronic
905533919 1:38703807-38703829 GCTGGACTTATGACTTACTTTGG - Intergenic
906261973 1:44399550-44399572 ACTGGTCTTTTTATTCTCTTAGG - Intergenic
907348522 1:53804918-53804940 ACAGTACATTTTAGTTATTTTGG + Intronic
908098812 1:60769450-60769472 ACTTGACTTTTAAGATGCTTTGG - Intergenic
908598586 1:65714266-65714288 ACTGCATTTTTTAGTTTATTTGG - Intergenic
909462101 1:75928670-75928692 ACTGATCTTTATAGCTACTTGGG + Intronic
910898098 1:92089874-92089896 ATTTGACTTTTTAGTAATTTTGG + Intronic
916403028 1:164469344-164469366 ACTGAACTTCTTAGTGATTTTGG + Intergenic
916659623 1:166910066-166910088 AATGGACTATTTAGGTCCTTTGG + Exonic
917144581 1:171875380-171875402 ACTGGCTTTTTAAGTAACTTTGG - Intronic
917271618 1:173281359-173281381 ACCTGGCTTTTTAGTTCCTTAGG + Intergenic
918336246 1:183516838-183516860 ACTAGGCTTTTTAATGACTTAGG - Intronic
918585329 1:186180755-186180777 ACTGGATATTTAAGTTTCTTTGG + Intronic
919541552 1:198852944-198852966 ACTGGGCTTTCTTGTTTCTTTGG - Intergenic
920350651 1:205335856-205335878 CTTGGACTTTTTCCTTACTTGGG - Intergenic
920714870 1:208330514-208330536 ATAGGTCTTTTTACTTACTTTGG - Intergenic
924388586 1:243525260-243525282 ACTGAATTTTTTATTTTCTTAGG - Intronic
1068667235 10:59689958-59689980 AGTGGAAGTTTTAGTTAATTTGG - Intronic
1070521991 10:77261925-77261947 ACTGGATTTTTAATTTAATTAGG + Intronic
1071019934 10:81041398-81041420 AGTGGTATTTTTAGTGACTTGGG + Intergenic
1072575466 10:96695804-96695826 ATTGGAATTGTTAGTTCCTTGGG - Intronic
1073919936 10:108446879-108446901 CCTGGACATTTTTGTTTCTTGGG + Intergenic
1077826838 11:5820111-5820133 ACTGTACTGCTTAGTGACTTTGG + Intronic
1078821621 11:14889140-14889162 ACTGGACTTTAAAATTGCTTAGG - Intronic
1079080109 11:17408053-17408075 CCTGGACTTTTTGGTTTCATGGG + Intronic
1084401508 11:68946527-68946549 ACTGGCCGTTTTTGTTCCTTTGG - Intergenic
1086014160 11:82144970-82144992 ACAGGACTTTTAAGATAATTGGG - Intergenic
1087934709 11:104018873-104018895 ACTGGACTTTTTAGTTCTTTAGG + Intronic
1088421297 11:109650436-109650458 CCTGGCCTTTTTCCTTACTTGGG + Intergenic
1088663333 11:112070154-112070176 ACTGGCCTTGTGACTTACTTTGG + Intronic
1089856513 11:121549946-121549968 AATTGCCTTTTTAGTGACTTCGG + Exonic
1090940400 11:131382864-131382886 TTTGGACTTTATAGTTACATAGG + Intronic
1092605432 12:10112880-10112902 ACTGTACTTTTTGGTACCTTTGG + Intergenic
1092729509 12:11515868-11515890 ATTGGACTTTTTAATGATTTAGG + Intergenic
1093013036 12:14128517-14128539 CCTGGACTTCCTACTTACTTTGG + Intergenic
1093508347 12:19896348-19896370 AGTGTACTTTTAAGTTACTAAGG + Intergenic
1093645174 12:21577927-21577949 TCTGGACTTTGAAGTTGCTTAGG - Intronic
1094348894 12:29500970-29500992 AATGTACATTTTTGTTACTTTGG - Intronic
1094365283 12:29673556-29673578 ACTGGAATTTCTAGTTCCTTTGG - Intronic
1094798666 12:34003922-34003944 ACTGGATTCTTTAGTTTCCTTGG - Intergenic
1095111415 12:38298008-38298030 ACTGGATTCTTTAGTTTCCTTGG - Intergenic
1095261384 12:40103853-40103875 GCTGGATTTTTTGGTCACTTTGG + Intronic
1095492604 12:42750109-42750131 ACCGAACTTTTTACTTATTTTGG - Intergenic
1096965576 12:55624655-55624677 ACTGTACTATTGAGTTTCTTTGG - Intergenic
1098469017 12:70822964-70822986 ACTTGACTTTTTTTTTAATTGGG - Intronic
1098564503 12:71917776-71917798 AGTGGATTTTGCAGTTACTTAGG + Exonic
1108924867 13:55729575-55729597 TCTAGACTTCTTAGTTCCTTAGG - Intergenic
1109614256 13:64809466-64809488 TGTGGACTTTTGAGTTAATTTGG + Intergenic
1109780102 13:67099102-67099124 ACTGTACTCTTTGGTGACTTTGG - Intronic
1110323838 13:74191075-74191097 ACCTGGCTTTTTAGTTATTTTGG - Intergenic
1111679229 13:91424017-91424039 ACAGGTCATTTTAGTTATTTTGG + Intronic
1117299821 14:54413819-54413841 ACTGTATTTTGTAGTTTCTTGGG + Intronic
1118307378 14:64666482-64666504 ACTGGTACTTTTTGTTACTTAGG - Intergenic
1118559059 14:67057925-67057947 ATTCTACTTTTTAGTTACATAGG - Intronic
1119846450 14:77833850-77833872 TCTAGACTTGTTAGTTACCTAGG + Intronic
1119846621 14:77835157-77835179 TCTAGACTTATTAGTTACCTAGG + Intronic
1120545959 14:85811680-85811702 ACTGTACTTTTTACCTACTCAGG - Intergenic
1123573971 15:21646668-21646690 ACTGCACTTTTTAGTTTATTTGG + Intergenic
1123610587 15:22089253-22089275 ACTGCACTTTTTAGTTTATTTGG + Intergenic
1123692530 15:22850486-22850508 ATTGGACTTTTTCATTTCTTGGG + Intronic
1123811781 15:23933782-23933804 ACTGTTCATTTTACTTACTTTGG + Intergenic
1127795772 15:62437096-62437118 AATGGACTTTTTAATCACTTTGG + Intronic
1128972669 15:72121264-72121286 GCTGTAATTTGTAGTTACTTTGG + Intronic
1129636753 15:77327081-77327103 AGTGGTATTATTAGTTACTTTGG - Intronic
1130191980 15:81745929-81745951 ACTCTACTTTTTAGTACCTTGGG - Intergenic
1131811072 15:96173616-96173638 ACAGGACTTTTTAATAAATTAGG + Intergenic
1132281505 15:100619982-100620004 ACTGAACTTTTTAATTAACTTGG - Intronic
1202982835 15_KI270727v1_random:381008-381030 ACTACACTTTTTAGTTTATTTGG + Intergenic
1132650042 16:1016524-1016546 TCTGAACTTTGTAGTTTCTTTGG + Intergenic
1134650967 16:15908449-15908471 ACTGGACATTTTAGATTCATGGG + Intergenic
1136226158 16:28862065-28862087 TCTGGACTTTTCGATTACTTGGG + Intronic
1139933074 16:70545445-70545467 GCTGGACTTTTTAGGTAATGTGG + Intronic
1143350819 17:6286702-6286724 ACGGGACTTTTTAATGACTGGGG + Intergenic
1148003185 17:44402744-44402766 CATGGACTTTTTAGTTTCTGTGG - Intronic
1149113612 17:53063877-53063899 CGTGGACTTTTGAGTTAATTTGG + Intergenic
1149221392 17:54418506-54418528 ACTGGCCTTTTAAGTTGCATGGG + Intergenic
1150982500 17:70158042-70158064 AATGGACTTTTTAGATCCTTTGG + Intergenic
1153764234 18:8360071-8360093 ACTGGATTTTTCTGTTTCTTTGG - Intronic
1154092683 18:11379706-11379728 AATGGACTATTTATTGACTTAGG + Intergenic
1157145148 18:45155030-45155052 ACTGGAGTGTTTAATTACATGGG - Intergenic
1157737543 18:50063375-50063397 ACCTGAATTTTTAGTTACTTAGG - Intronic
1158919583 18:62175813-62175835 ACTGTACTTTTTAGTGAACTGGG - Intronic
1159195107 18:65103240-65103262 CTTGGACTTTTGAGTTACTCAGG + Intergenic
1159376149 18:67596414-67596436 ACTGGACTTTTTTTTCAGTTAGG + Intergenic
1159454057 18:68638721-68638743 ACTGGACTTTTGGGTTGCGTGGG - Intergenic
1159733975 18:72071144-72071166 GCTGCACATTTTAGTTAATTTGG - Intergenic
1162218374 19:9155781-9155803 CCTGGACTTTTATCTTACTTAGG - Intronic
1164448467 19:28337809-28337831 CCTGGAGTTTTTAGTTAAGTTGG + Intergenic
1164496321 19:28766810-28766832 ACTGGACTCTTTAGTTTCTTTGG - Intergenic
1164660760 19:29964819-29964841 ATTTGACTTTTTTGTTACCTGGG + Intronic
1166802097 19:45464307-45464329 CCTGTAGTTGTTAGTTACTTGGG + Intronic
1168497666 19:56867533-56867555 TCTGGCATTTTCAGTTACTTAGG - Intergenic
931086918 2:58842566-58842588 ATTGGACTTGGTAGCTACTTTGG + Intergenic
937555414 2:123148707-123148729 ACTGTACTTTTTGGTTAAATAGG + Intergenic
938850298 2:135252727-135252749 AGAGGACTTTATAGTTAATTTGG - Intronic
939915962 2:148043490-148043512 AATAGACTTTCTAGTTACTTGGG + Intronic
940015269 2:149097989-149098011 ACTACACTTTTTTATTACTTTGG + Intronic
942283785 2:174393408-174393430 ACTGGACTTTTTATAAGCTTGGG + Intronic
942679127 2:178458283-178458305 TCTGCACTTTTCACTTACTTTGG - Intronic
943183043 2:184568045-184568067 ACTGGACATTTTTGTTATTTGGG - Intergenic
943458141 2:188134012-188134034 ATTGGACTGATTAGATACTTTGG - Intergenic
944836387 2:203584403-203584425 ACTGGGAGTCTTAGTTACTTGGG - Intergenic
945475126 2:210272761-210272783 ACTTGAGTTTTCATTTACTTTGG - Intergenic
946885492 2:224218312-224218334 GTTGGACTTTTGATTTACTTTGG - Intergenic
1170506023 20:17026653-17026675 ACTCCACTCTTCAGTTACTTAGG + Intergenic
1171066957 20:22026777-22026799 ACTGGCCTTTTTGGTTGCATGGG - Intergenic
1172928523 20:38563751-38563773 TCTGGAATTTTTAGTTACATGGG - Intronic
1173071288 20:39769257-39769279 TCTGGGCTTTTTTGTTACTGTGG + Intergenic
1173936394 20:46869849-46869871 ATTGGACTTTTCAGTTGCATGGG - Intergenic
1178182308 21:30176344-30176366 ATTAGAGTTTTTAGTTACTTTGG - Intergenic
1179396887 21:41048529-41048551 ACTGGTCTTTTTTGTTAATTGGG - Intergenic
1183801318 22:40167264-40167286 AATGGACTTATGAGTGACTTCGG - Intronic
949141707 3:641586-641608 AATAGACTCTTGAGTTACTTTGG + Intergenic
949176063 3:1063661-1063683 AGTGAACTTTTAAGTTACATAGG + Intergenic
949755942 3:7410814-7410836 ACAGGATTTTTTATTTACTAAGG + Intronic
950900209 3:16490734-16490756 ATTGGACATTTAAGTTATTTTGG - Intronic
951617351 3:24562479-24562501 ACCAGACTTTTTAATTTCTTAGG - Intergenic
951947656 3:28158853-28158875 ACTGAACTTTTTAATCAGTTCGG - Intergenic
952487840 3:33833790-33833812 AGTTGACTTTTCAGTTACTTAGG + Intronic
952519847 3:34145628-34145650 ACAGGATTTTTGAGTGACTTTGG - Intergenic
954529543 3:51306981-51307003 ACTGGACATTTTAATTAATTTGG + Intronic
956048461 3:65221554-65221576 GCTCAACTTTTTAGCTACTTGGG + Intergenic
956146976 3:66200137-66200159 ACTACTCTTTTTTGTTACTTTGG + Intronic
956363523 3:68474058-68474080 GCTTGGCTTTTTATTTACTTGGG - Intronic
958070925 3:88610317-88610339 ACTGGAAATTTTAGTTTCTGTGG + Intergenic
960205700 3:114894843-114894865 AATGGAATTTTTATTTAGTTGGG - Intronic
960810841 3:121626101-121626123 TTTAGACTTTTTAGTTACATAGG - Intronic
961260300 3:125596251-125596273 TCTGTACGTTTTAGTTACTTGGG + Intergenic
962328806 3:134459494-134459516 CCTGGACTTTTTAGTTACATGGG - Intergenic
962773263 3:138633106-138633128 TCAGGACTTTTTAATTACTGTGG + Exonic
964629859 3:158798653-158798675 AATGATCTTTTTAGTTAGTTTGG - Intronic
964631373 3:158814146-158814168 ACTGGAATTTGTATCTACTTTGG + Intronic
964848112 3:161065761-161065783 AATGGGCTTTTTAGTTCTTTTGG - Intronic
966462106 3:180188154-180188176 CCTGGACTTTTCAGTTAATTTGG - Intergenic
966708728 3:182948636-182948658 AAAGGACTTTTAAGTTACTTAGG - Intronic
967032752 3:185623549-185623571 TCTGGATTTTTTATTTAATTTGG - Intronic
970381261 4:15510180-15510202 ACTTGACTCTTGAGTAACTTTGG - Exonic
971674049 4:29601625-29601647 AGTGGATTTTTATGTTACTTTGG + Intergenic
973910512 4:55575244-55575266 ACTGTACTTTTTAGTTCCTCTGG - Intronic
974377453 4:61096667-61096689 AATGGACTTTTTTGTGTCTTTGG - Intergenic
974509949 4:62826519-62826541 ACTGATCTTTCTAGTTACTAGGG + Intergenic
975464861 4:74697846-74697868 ACTGCACTTTTTAATGCCTTTGG + Intergenic
975598488 4:76074178-76074200 ACTGGACTTTGTCTATACTTGGG + Intronic
976425450 4:84897652-84897674 AATGCACTTTTAAGATACTTGGG + Intronic
977521682 4:98092881-98092903 ACTGGAAATTTTAGTTCTTTTGG - Intronic
978816233 4:112909072-112909094 ACTAAACTTTTTAGATACTGGGG + Intronic
981255642 4:142657899-142657921 ACCGGGCTTTTCAATTACTTCGG + Intronic
981336687 4:143576163-143576185 ATTGTATTTTTTTGTTACTTAGG - Intergenic
981671036 4:147287188-147287210 AGTGGAATTTATAGTTATTTTGG - Intergenic
982981572 4:162143188-162143210 TCTGTAATTTTTATTTACTTAGG + Intronic
984603048 4:181751268-181751290 ACTGGACTCTTCATTTACTGAGG - Intergenic
984657742 4:182337686-182337708 ACTTAAGTTTTTATTTACTTTGG - Intronic
985481720 5:115942-115964 AGTGGACTTTTAATTTCCTTCGG + Intergenic
989057017 5:37375602-37375624 ACTGTATTTTTCAGTTACATAGG - Intergenic
990098577 5:52153724-52153746 ACTAGACTTTTTCCTTACTAGGG - Intergenic
991967315 5:72106468-72106490 AATGTACTTTTCAGTTCCTTGGG - Intergenic
994762327 5:103870780-103870802 ACTAGAATTTTTATTTACTGAGG - Intergenic
995034229 5:107515083-107515105 AGTGGACTTTCTAGTTGATTGGG - Intronic
995051732 5:107714602-107714624 ACTGTACTTCTTAGTTGCATTGG - Intergenic
995225926 5:109700913-109700935 AAAGAACTTTTTAGTTATTTAGG + Intronic
995359206 5:111274905-111274927 ACTGGACTTTTTCATTACATAGG - Intronic
996251807 5:121344091-121344113 ACAGGACATTTTAGTCATTTTGG + Intergenic
996692813 5:126358828-126358850 ACTGGTCTTGTTACTTGCTTTGG - Intergenic
997252975 5:132404967-132404989 ACTGCCCTTTATATTTACTTAGG - Intergenic
997902625 5:137781269-137781291 ACTTGACTTTTTATTTATTTTGG + Intergenic
1005490156 6:26340730-26340752 TGTAGACATTTTAGTTACTTGGG - Intergenic
1006488951 6:34369255-34369277 TCTTGACTTTTTATTTACTGGGG + Intronic
1006949842 6:37812678-37812700 TCTGGACTTTTCAGTTACATGGG - Intergenic
1008030894 6:46692594-46692616 ACTGGCACTTTTAATTACTTGGG - Exonic
1008654796 6:53601081-53601103 ACTGGATTTTTTAGACACGTAGG + Intronic
1008801866 6:55378291-55378313 ACTAGAATTTATACTTACTTTGG - Intronic
1008856495 6:56094574-56094596 ACTCTACATTTTAGGTACTTAGG + Intronic
1008951249 6:57162023-57162045 ACTGCACTTTTTAATAACCTGGG + Intronic
1009637662 6:66285999-66286021 ATTGGACTTTTGAGTTAATGCGG + Intergenic
1011725566 6:90206953-90206975 ATTGGACTGTTTAGTTCATTTGG - Intronic
1015983951 6:138867275-138867297 ACTAGACATTTAAATTACTTTGG + Intronic
1015996184 6:138997668-138997690 GCTTGACTTTTTATTCACTTAGG + Intergenic
1016674843 6:146751937-146751959 ACTGGAGTTATTAGAGACTTTGG - Intronic
1017545225 6:155443467-155443489 ACTGTATTTTTTAGTAACTAGGG - Intronic
1018048983 6:159991038-159991060 ACTTGACTTTTTAGTGTTTTTGG + Intronic
1020603313 7:10303752-10303774 ACTAGATTTTGTAGTTCCTTTGG + Intergenic
1021112228 7:16708646-16708668 ACTGTGCTTTTTGGTTACCTTGG - Intergenic
1021681742 7:23140100-23140122 ACTGAACTTTTGTATTACTTTGG - Intronic
1021903535 7:25311192-25311214 TCTGGACTTTTCAGTTACCCAGG + Intergenic
1022870918 7:34478834-34478856 ACTTGTGTTTCTAGTTACTTAGG - Intergenic
1022893226 7:34722513-34722535 TCTGGACTTTTTAGTTTTTCTGG + Intronic
1023234506 7:38070058-38070080 ACTTGACTTATTAGATCCTTAGG + Intergenic
1023620432 7:42066416-42066438 ACTGGACTTTTTAGTTACTTAGG - Intronic
1023873608 7:44275478-44275500 ACAGGACTTTGTCATTACTTTGG - Intronic
1024559516 7:50631532-50631554 AATGGAGTTTTTAGTAACTCTGG + Intronic
1024719259 7:52116766-52116788 ACTGGTCTGTTTGGTTAATTAGG - Intergenic
1028172276 7:87612827-87612849 ACTGAACTTTTAGATTACTTTGG + Intronic
1028459890 7:91080024-91080046 TCTGGATTTTGTAGTTACTCAGG + Intronic
1028498217 7:91486539-91486561 ACTGTGCTGTTTAGTTACTCTGG - Intergenic
1028543726 7:91974733-91974755 ACAGGATTTTTTATTTATTTAGG + Intronic
1028799245 7:94943055-94943077 CATGGACTATTTAGTTATTTTGG + Intronic
1030375752 7:108751514-108751536 ACTTTACTTTTTAGTTACTAGGG - Intergenic
1031588225 7:123558096-123558118 ACTGGAGTTTTTTGGTAGTTGGG - Intronic
1033179512 7:139162194-139162216 ACTGCACATTTTAGTCACCTGGG + Intronic
1037149984 8:15625675-15625697 ACTGAAGTTATTAGTAACTTGGG + Intronic
1038210298 8:25512472-25512494 ACTGAATCTTTTAGTAACTTAGG - Intergenic
1040665605 8:49628406-49628428 ACTGGACTTTTCAGAGACTATGG + Intergenic
1040819555 8:51540913-51540935 ACTGTGATTTTTAGTTTCTTGGG + Intronic
1041875484 8:62682661-62682683 ACTGGCCTTTTAAGTTGCATGGG + Intronic
1042890198 8:73601190-73601212 TCAGAACTTTTTAGTTTCTTAGG - Intronic
1043229768 8:77787480-77787502 ACTGGCCATTTGAGTTACTAGGG + Intergenic
1043429198 8:80178358-80178380 ACTGGTCTCTTTAGGTACGTGGG - Intronic
1043621270 8:82195278-82195300 ATTGGTCGTTTTATTTACTTTGG - Intergenic
1045102839 8:98862603-98862625 ACAGGACTTTTTAGAGACATTGG + Intronic
1046336106 8:112789631-112789653 ACTGAAATTTCTAGTTTCTTAGG - Intronic
1050261540 9:3846230-3846252 ATGGAAATTTTTAGTTACTTGGG - Intronic
1051493525 9:17693707-17693729 ACTGGAGTTCTTAGCAACTTTGG - Intronic
1052015416 9:23458892-23458914 AGTTGACTTTTTTCTTACTTTGG - Intergenic
1052618208 9:30870997-30871019 TCTGGAATTTTTAGGTACTCGGG + Intergenic
1053425926 9:38010031-38010053 ATTGGAAAATTTAGTTACTTAGG - Intronic
1053588047 9:39480830-39480852 ACTGAACTTTTTTTTTTCTTAGG + Intergenic
1054578259 9:66884457-66884479 ACTGAACTTTTTTTTTTCTTAGG - Intronic
1055213265 9:73825191-73825213 TCTGGACTTTTTAGTTACATAGG + Intergenic
1055735962 9:79330828-79330850 ACATGACTTTTTAGGTTCTTTGG + Intergenic
1057526708 9:95809469-95809491 TCTTGTCTTTTTAGGTACTTTGG + Intergenic
1187087279 X:16054034-16054056 AATGAACATTTTAGTTACCTTGG - Intergenic
1194763937 X:97827273-97827295 ATTTGACTTTTAAGTAACTTTGG - Intergenic
1196495030 X:116314641-116314663 AGTAGACTTTATAGTTATTTTGG + Intergenic
1197263619 X:124342875-124342897 ACTGGACCTATGAGCTACTTAGG + Intronic