ID: 1023620439

View in Genome Browser
Species Human (GRCh38)
Location 7:42066443-42066465
Sequence CTGGGTTAAAAGATGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023620431_1023620439 14 Left 1023620431 7:42066406-42066428 CCAATAATAACCTAAGTAACTAA 0: 1
1: 0
2: 2
3: 9
4: 208
Right 1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG No data
1023620432_1023620439 4 Left 1023620432 7:42066416-42066438 CCTAAGTAACTAAAAAGTCCAGT 0: 1
1: 0
2: 4
3: 22
4: 198
Right 1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG No data
1023620429_1023620439 20 Left 1023620429 7:42066400-42066422 CCACCACCAATAATAACCTAAGT 0: 1
1: 0
2: 2
3: 7
4: 150
Right 1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG No data
1023620430_1023620439 17 Left 1023620430 7:42066403-42066425 CCACCAATAATAACCTAAGTAAC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023620439 Original CRISPR CTGGGTTAAAAGATGGGGAA AGG Intronic
No off target data available for this crispr