ID: 1023620439 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:42066443-42066465 |
| Sequence | CTGGGTTAAAAGATGGGGAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1023620431_1023620439 | 14 | Left | 1023620431 | 7:42066406-42066428 | CCAATAATAACCTAAGTAACTAA | 0: 1 1: 0 2: 2 3: 9 4: 208 |
||
| Right | 1023620439 | 7:42066443-42066465 | CTGGGTTAAAAGATGGGGAAAGG | No data | ||||
| 1023620432_1023620439 | 4 | Left | 1023620432 | 7:42066416-42066438 | CCTAAGTAACTAAAAAGTCCAGT | 0: 1 1: 0 2: 4 3: 22 4: 198 |
||
| Right | 1023620439 | 7:42066443-42066465 | CTGGGTTAAAAGATGGGGAAAGG | No data | ||||
| 1023620429_1023620439 | 20 | Left | 1023620429 | 7:42066400-42066422 | CCACCACCAATAATAACCTAAGT | 0: 1 1: 0 2: 2 3: 7 4: 150 |
||
| Right | 1023620439 | 7:42066443-42066465 | CTGGGTTAAAAGATGGGGAAAGG | No data | ||||
| 1023620430_1023620439 | 17 | Left | 1023620430 | 7:42066403-42066425 | CCACCAATAATAACCTAAGTAAC | 0: 1 1: 0 2: 0 3: 11 4: 104 |
||
| Right | 1023620439 | 7:42066443-42066465 | CTGGGTTAAAAGATGGGGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1023620439 | Original CRISPR | CTGGGTTAAAAGATGGGGAA AGG | Intronic | ||
| No off target data available for this crispr | |||||