ID: 1023621183

View in Genome Browser
Species Human (GRCh38)
Location 7:42074703-42074725
Sequence TGTGGCCTCCTGGGACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023621183 Original CRISPR TGTGGCCTCCTGGGACTGCC TGG (reversed) Intronic
900179386 1:1304623-1304645 TGGGTCCTCCTGGTGCTGCCAGG - Intronic
900652420 1:3736390-3736412 AGTAGCCTCATGGGACTGACCGG + Intergenic
900807034 1:4774290-4774312 TGTGGACTCCTGGCCTTGCCAGG - Intronic
900896009 1:5483446-5483468 TGTGTTGCCCTGGGACTGCCTGG + Intergenic
900997043 1:6128390-6128412 TTGGGCGTCCTGGGACTGCCAGG - Intronic
901023082 1:6264838-6264860 GCTGGCCTCCTGGGACTGCCGGG + Intronic
901150075 1:7095487-7095509 CGTGCCCTCCTGGGACTGCATGG + Intronic
901229923 1:7636054-7636076 CTTGGTCTCCTGGAACTGCCAGG + Intronic
901634250 1:10663305-10663327 TGTGGGCTCCGGGGAGGGCCTGG + Intronic
901862584 1:12084380-12084402 TCAGGCCTCCTGGGACTGGTGGG + Intronic
901948029 1:12719271-12719293 TGTGGCCACCTGGGCCTGCATGG + Intronic
902512999 1:16976319-16976341 TGGGACCTCCTGGAGCTGCCTGG + Intronic
903348014 1:22700065-22700087 TGTGTCCCCCAGGGGCTGCCTGG + Intergenic
903744128 1:25575215-25575237 GGGGGCCTCCTGGGAAAGCCAGG + Intergenic
904316486 1:29669527-29669549 TGGAACCTCCTGGGTCTGCCGGG - Intergenic
904469910 1:30729857-30729879 TGAGGCCTCCTGCTTCTGCCAGG + Intergenic
904939702 1:34157099-34157121 GGTGGCCACATGGGACTCCCAGG + Intronic
906078525 1:43068956-43068978 AGGGGTCTGCTGGGACTGCCTGG - Intergenic
907308401 1:53526108-53526130 TCTGCCCTGCTGGGACTGCAGGG + Intronic
907336386 1:53702466-53702488 TGTGGCCTCCTGGGAGAGGGTGG + Intronic
910228080 1:84956896-84956918 TGTGAGCTCCAGGAACTGCCTGG - Intronic
910556092 1:88534870-88534892 AGTGGCCTCTTGGGGCTGTCAGG + Intergenic
911089573 1:94007715-94007737 TTTGGCCTCCTGGGAGTGAATGG - Exonic
914980391 1:152410043-152410065 TGTGTCCTCCTGTCACAGCCTGG + Exonic
915148716 1:153811730-153811752 GGTGGCCTCCTTGGTATGCCAGG - Exonic
915317366 1:155036716-155036738 TCAGGCCTACTGGGACAGCCAGG - Intronic
915362581 1:155294979-155295001 TGGGGACTCCTGGGACGGGCTGG + Intronic
915541330 1:156568596-156568618 TGTGGCCTCCTCGACCTCCCAGG + Intronic
916033008 1:160894884-160894906 TGTGGCCGGCTGGGAGTGCCAGG - Intergenic
916361844 1:163979101-163979123 TGTGCCCCCTTGGGCCTGCCAGG + Intergenic
919821440 1:201475504-201475526 TGGGGAATCCTGGGAATGCCTGG - Intergenic
920331307 1:205210825-205210847 CATGGCCTCCTCGGACTCCCGGG + Intronic
922193346 1:223339104-223339126 GGTCTCCTCCTGTGACTGCCAGG - Intronic
924651959 1:245937835-245937857 TGAGGCGTCCTGGTACTGCTGGG - Intronic
1063121458 10:3107760-3107782 TGTGTCCTCGTGGCCCTGCCTGG + Intronic
1063277956 10:4592047-4592069 TCTTGCCTCATGGCACTGCCTGG + Intergenic
1063831372 10:9957534-9957556 TGAGGCCTTCTAGGACTTCCCGG - Intergenic
1066038501 10:31520293-31520315 TGTGGTCGTGTGGGACTGCCTGG - Exonic
1066051841 10:31643507-31643529 TGAGGCCTTCTGGGACTGGCAGG - Intergenic
1067058442 10:43065473-43065495 TGGGGCCAGCTGGGCCTGCCCGG - Intergenic
1067191162 10:44069347-44069369 AGGGGCCTCATGGGTCTGCCCGG - Intergenic
1068917764 10:62451371-62451393 TGTGGCCTCCAGGGTCTTCATGG + Intronic
1069825773 10:71254223-71254245 TGTGCCCTACTGGGGCTGGCGGG + Intronic
1069991808 10:72320887-72320909 TCTAGTCTCCTGGGACTGTCAGG + Intergenic
1070456961 10:76626871-76626893 TCTGCCCTCCTGGGGCTCCCTGG + Intergenic
1074406035 10:113181042-113181064 AGTGTCCTCCTGGGAGGGCCTGG + Intergenic
1075337718 10:121620549-121620571 AGTGGCCTCCTGGGTATGCAGGG - Intergenic
1075622527 10:123938575-123938597 TGTGACCTCCTGGAGCTGCAAGG + Intronic
1075907413 10:126093634-126093656 GGCTGGCTCCTGGGACTGCCTGG + Intronic
1076202244 10:128567990-128568012 TGTGGCTCCCTGGCACTGCTAGG - Intergenic
1076671034 10:132121216-132121238 AGTGGCCTCCCGGGCCTGGCAGG + Intronic
1076853548 10:133104568-133104590 TGCTTCCTCCTGGGGCTGCCTGG + Intronic
1077273488 11:1692695-1692717 TGTGGCTTCCTGGGGATGCAGGG - Intergenic
1077703989 11:4466723-4466745 TGGGGCTGCCTGGGGCTGCCAGG + Intergenic
1078003891 11:7518059-7518081 TGTGGCCCCGTGGGCCTGCAGGG + Intronic
1078143764 11:8709504-8709526 TCTGGCCGCCTGGGCCTCCCAGG - Intronic
1078552622 11:12290854-12290876 TGTGGCCTCCTGGGGGTGGAGGG + Intronic
1078952353 11:16148550-16148572 TGTGTTCCCCTGGGAATGCCTGG + Intronic
1081061341 11:38481647-38481669 TGGGGTCTCCTCCGACTGCCTGG - Intergenic
1081876419 11:46411394-46411416 TGGGACCTCCTGGGACCTCCTGG - Intronic
1082109919 11:48263176-48263198 GGTGGCCGCCAGGGACTGCAGGG - Intergenic
1083673771 11:64314336-64314358 GGGGGCCTCCAGCGACTGCCAGG - Exonic
1083794236 11:65005468-65005490 AGTGGACTCCTGGGACTGGCAGG + Intergenic
1083989142 11:66236056-66236078 TTTTGCCTCCAGGGACTACCTGG + Intronic
1084489134 11:69468889-69468911 TGTGGCCTCCTGAGACACTCTGG + Intergenic
1089415342 11:118284607-118284629 TGCAGCCTCCTGGGACTCCTGGG - Intergenic
1091389757 12:118852-118874 TGTGGCTGCCAGGGCCTGCCTGG + Intronic
1091783299 12:3227548-3227570 TGCGGCTTCCTGGTGCTGCCAGG - Intronic
1095092623 12:38121269-38121291 GTTTCCCTCCTGGGACTGCCAGG + Intergenic
1096227031 12:49872598-49872620 CCTGGCCTCTTGGGCCTGCCGGG - Intronic
1099861482 12:88229663-88229685 TGTGGCCCCGTGGGCCTGCAGGG - Intergenic
1100804035 12:98262365-98262387 TGTGGCCTCCAGGGACTGTTAGG - Intergenic
1101878938 12:108613564-108613586 TGTGGCTTCCTTGGGCTTCCCGG + Intergenic
1102715533 12:114968597-114968619 ATTGGCCTCCTGTGGCTGCCAGG - Intergenic
1102954185 12:117048786-117048808 TGTGGCTTCCTGGGACTAGAAGG - Intronic
1103627024 12:122227106-122227128 TCTGGCCAGCTGGGACTGCAGGG + Intronic
1104105004 12:125650739-125650761 TGTGGCGTGCTGGTACTGCAGGG - Exonic
1104519787 12:129462957-129462979 TGTGGGCTCCGAGGACTCCCAGG - Intronic
1104736211 12:131137378-131137400 TGTGGCCTCCTTGGACTCTGGGG + Intronic
1104903558 12:132201878-132201900 TGTGTCTTCCTGGGACTGTGGGG + Intronic
1105017461 12:132794407-132794429 ACTGGCCTCCTGGGCCTGCCTGG - Intronic
1105018118 12:132798535-132798557 TGGGGCCTCCAGGGACAGGCTGG - Intronic
1105344489 13:19560720-19560742 GGGGGCCTCCAGCGACTGCCAGG + Intergenic
1105387621 13:19946298-19946320 TGTGGCCTCCAAGGCCTTCCAGG + Intergenic
1105535543 13:21260855-21260877 GGGGGCCTCCAGCGACTGCCAGG - Intergenic
1105975031 13:25466120-25466142 TGTGGCCTCCTGTGACCTTCAGG + Intronic
1106300414 13:28459310-28459332 TGTGGCCTCCTGGTAATGCAGGG + Intronic
1106554455 13:30797984-30798006 AGTGGCTGCCTGGGACTCCCAGG - Intergenic
1107890037 13:44906026-44906048 TGTGCCCTGCAGGGACTCCCAGG + Intergenic
1108324147 13:49313750-49313772 TCTGGCCTCCTGCCTCTGCCTGG + Intronic
1110116152 13:71819057-71819079 GGTGGCATCCTGGGGCTGCCAGG + Intronic
1112806952 13:103173379-103173401 TGTGGCCTCCAGGGTCTGAACGG - Intergenic
1113480776 13:110619010-110619032 TGTGCCCTCCTGGGAGTGCTGGG + Intronic
1113633584 13:111904798-111904820 GGTGGCCTCCAGGGCCTGCCGGG - Intergenic
1113664415 13:112131479-112131501 CGTAGCCTCCAGGGCCTGCCTGG + Intergenic
1115713204 14:36073093-36073115 TGCGGCCTGCTGGGAGTGGCAGG + Intergenic
1118195225 14:63619151-63619173 TGGGGCCTGCTGGGACTGAGTGG + Intronic
1119704792 14:76776824-76776846 TGGGTTCTCCTGGGGCTGCCAGG + Intronic
1120949289 14:90026297-90026319 TGTGGCCTCCTGGGAAACCCTGG - Intronic
1121323776 14:93007964-93007986 GGTGGCCTCCTGGGAGCGCTGGG - Intronic
1121795176 14:96728567-96728589 TGTGGTCTGCAGGGAGTGCCGGG - Intergenic
1122249462 14:100427801-100427823 TCTGGCCTCCTGTCCCTGCCTGG - Intronic
1122684208 14:103491941-103491963 TGTGGCTTCATGGGACAGGCTGG - Exonic
1122800175 14:104225439-104225461 TGTGGCTCCCTGGGGCTGCTCGG + Intergenic
1122800242 14:104225719-104225741 TGTGGCTCCCTGGGGCTGCTCGG + Intergenic
1122803508 14:104244926-104244948 TGTGGGCTCTGGGGACTGCATGG + Intergenic
1123054227 14:105561649-105561671 AGGGCCCTCCTGGGGCTGCCTGG - Intergenic
1123078811 14:105682068-105682090 AGGGCCCTCCTGGGGCTGCCTGG - Intergenic
1123089928 14:105737954-105737976 TGTGGCCTGCGTGGACTGACGGG - Intergenic
1123783080 15:23645874-23645896 GGGGGCCTTCTGGGCCTGCCAGG + Exonic
1124363766 15:29057009-29057031 TGTTGGCTCCTGGCACGGCCTGG - Intronic
1124796612 15:32787332-32787354 TGTGGCCTTGTTGGCCTGCCTGG - Intronic
1124971621 15:34495079-34495101 TGTGGCCTTCCGCGACTGCGAGG + Intergenic
1129364838 15:75047909-75047931 TGTGGCTTGGTGGGACGGCCTGG + Intronic
1130099532 15:80881969-80881991 TGAGAGCTCCTGGGACTGCAGGG - Intronic
1130902944 15:88220642-88220664 TGTGGGCTCCTGTGACTGCCTGG - Intronic
1131419046 15:92288171-92288193 AGTGGCCTCCTGCCACTCCCGGG + Intergenic
1131581731 15:93649810-93649832 TCTGCCCTCCTGAGACTTCCAGG - Intergenic
1132313425 15:100873887-100873909 TGTGTTCTCATGGGAATGCCTGG - Intergenic
1132647655 16:1006582-1006604 TGTGGGCTCTTGGGACTGAAGGG + Intergenic
1132891928 16:2208880-2208902 TGTGACCCCTCGGGACTGCCTGG + Exonic
1134378064 16:13697612-13697634 TCTGCCTTCCTGGAACTGCCAGG - Intergenic
1134914864 16:18060945-18060967 CCTGTCCTCCTGGGACCGCCAGG - Intergenic
1135136076 16:19885883-19885905 GGGGGCCACCTGAGACTGCCAGG - Intronic
1135396630 16:22136607-22136629 TGTGGACTCCTGGGAGGGCAGGG + Intronic
1135414773 16:22260633-22260655 TGTGCCCTCCTGGCAGTGCCTGG - Intronic
1136177584 16:28528526-28528548 TGTGGCCTTCAGGGAGTCCCAGG - Intergenic
1137056086 16:35747286-35747308 TGTGGCCCCCTGGTGCTACCAGG - Intergenic
1137506377 16:49057482-49057504 TCTGCCCTCCTGGGACTGCATGG + Intergenic
1138171006 16:54849647-54849669 GGTGCCCTGCTGGCACTGCCAGG + Intergenic
1138291270 16:55849268-55849290 TGTGGCCTCATGGGATTTCTGGG + Intronic
1139367295 16:66441353-66441375 AGTGCCCTCCTGGGATTTCCGGG - Intronic
1141433254 16:83981734-83981756 AGTTGCCTCCTGGGTGTGCCTGG - Intronic
1141560999 16:84867763-84867785 TGTTTCCCCCTGGGACTTCCAGG + Intronic
1142005479 16:87687769-87687791 TGGGGTCTCCTGGGCCAGCCAGG + Intronic
1142172057 16:88628055-88628077 TGTGCCCTGCTGGGGCTGCCCGG - Exonic
1142388587 16:89783147-89783169 TGTGGCCTCCCTGGAGTCCCAGG - Intronic
1142541515 17:663364-663386 TGTGGCCTGCTGGCACTCACAGG - Intronic
1142551967 17:746386-746408 TGTGGCCTCCGTGGCCCGCCTGG - Exonic
1143247789 17:5500747-5500769 TGCGGCCTTCGGGGGCTGCCCGG + Intronic
1143259083 17:5584822-5584844 TGGGGCCCCCTGTGTCTGCCCGG + Intronic
1143445338 17:7005957-7005979 CGGGGCCTGCTGGGACTCCCAGG + Exonic
1144487971 17:15683446-15683468 AGTGCCCTGCTGGGAGTGCCTGG + Intronic
1144913051 17:18698843-18698865 AGTGCCCTGCTGGGAGTGCCTGG - Exonic
1145001169 17:19305736-19305758 TGTCTGCTCCAGGGACTGCCCGG - Intronic
1145227346 17:21141189-21141211 GGTGGCCTCCTGGGGGTGTCTGG - Intronic
1146664870 17:34692704-34692726 TGTGACCTCCTGCAAGTGCCTGG - Intergenic
1147121654 17:38338686-38338708 TGTGGCCTGCTGGGGCTGGTGGG - Intronic
1147647275 17:42041181-42041203 AATGGCCACCTGGGACAGCCAGG + Intronic
1148199397 17:45739962-45739984 TGGGGCCTCCTGGGACAGTTGGG + Intergenic
1149686858 17:58540694-58540716 TGCTGCCCCCTGGGAATGCCTGG - Exonic
1150160753 17:62895889-62895911 TGTGGCACCCTGGAAATGCCCGG + Intergenic
1151574824 17:74947515-74947537 TGAGGCTTTCTGGGTCTGCCTGG - Intronic
1151763818 17:76122055-76122077 TGGGGGCTCCTGGGCCTGCTGGG - Intergenic
1151883865 17:76911923-76911945 TGGGGCCTCCTGAGGCTGCAAGG + Intronic
1152309177 17:79538738-79538760 GGTGGCCTCCTGGGTCTCCTGGG - Intergenic
1152571694 17:81123887-81123909 TGCAGCCTCTTGGGACAGCCAGG - Intronic
1152614467 17:81331442-81331464 GGGGGCCTCCTGGGACTCCTTGG + Intergenic
1152690662 17:81716391-81716413 TGTGCCCTCCTGCCACGGCCTGG + Intronic
1153220091 18:2853717-2853739 TGAGACCTCCAGGGGCTGCCAGG - Intronic
1154183151 18:12155352-12155374 TGTGGCCTCCTGCAAGTTCCTGG - Intergenic
1155240165 18:23857080-23857102 TGCTGCCTCCTGGGATTGCTGGG - Intronic
1157294570 18:46433388-46433410 TGTGACGTCCTGGAACTGCAGGG - Exonic
1157583108 18:48784649-48784671 TGGAGCCTCCTGGGAGAGCCAGG + Intronic
1157606511 18:48929325-48929347 TGTGTCTTCCTGGGGGTGCCAGG - Intronic
1159207928 18:65278315-65278337 TGTGGGATCCTGGGACAGCCTGG - Intergenic
1159881567 18:73863063-73863085 TGTGTGGTCCTGGGACTGGCTGG - Intergenic
1160729287 19:633433-633455 TGCGGCCGCCCGGGACTCCCCGG - Exonic
1160843985 19:1158680-1158702 TGCGGCCTCCAGGGACTGTGCGG - Intronic
1160849027 19:1180802-1180824 TGTAGCCTCCTGGGTCGGGCAGG - Intronic
1161427589 19:4212467-4212489 GCTGGCCTCCGGGGACTGACGGG - Exonic
1161514821 19:4690450-4690472 AGTGGTCTCCTGGGACAGCGGGG + Intronic
1161743035 19:6036223-6036245 TCTGGTCTGCTGGGGCTGCCTGG + Intronic
1162578966 19:11516185-11516207 TGTGACCTCCTGGGACTTGGGGG - Intronic
1163113967 19:15178305-15178327 CGTGGCCTCCTGGGATGGCAGGG - Intronic
1163372077 19:16906920-16906942 TGTGGCCTCTGGGGAGGGCCAGG + Intronic
1163401123 19:17093468-17093490 CGTGGCGTCCTGGGACGACCAGG + Intronic
1163666467 19:18606188-18606210 TCTGGGCCCCTGGGACTGCAGGG - Intronic
1163827174 19:19530200-19530222 TCAGGCCTCCTGGGTCTGACAGG + Intronic
1163939404 19:20478372-20478394 TGTGGCCCCATGGGCCTGCAGGG + Intergenic
1164990065 19:32676500-32676522 GGTGGCCTTCTCGGGCTGCCTGG + Exonic
1165096008 19:33410320-33410342 CATGGCCTACTGAGACTGCCCGG - Intronic
1165992909 19:39826278-39826300 TGGAGCCTCCTGGAAGTGCCAGG + Exonic
1166715531 19:44964842-44964864 TTTGTCCTTCTGTGACTGCCTGG + Intronic
1167499369 19:49836622-49836644 TGTGTGCTCCTGGGATTGCTGGG + Intronic
1167638058 19:50666754-50666776 TGTGGCCTACCTGGACGGCCAGG - Exonic
925897893 2:8487487-8487509 TCTGCCCTCCAGGGGCTGCCAGG + Intergenic
926749690 2:16188742-16188764 TGTGGCTTCCTGGTCCTTCCCGG + Intergenic
927173051 2:20386596-20386618 TGTGGCCTCCTGGCCATGCTGGG + Intergenic
927303585 2:21543951-21543973 TGTGCCCTACTGGGACCGGCAGG - Intergenic
927670684 2:25066232-25066254 AGTGGCCTCCTGGGAGGGTCAGG + Intronic
929146257 2:38709208-38709230 GCTCCCCTCCTGGGACTGCCAGG - Intronic
930682537 2:54272294-54272316 TCTGGGCTCCTGTGACTGGCAGG + Intronic
930863775 2:56103117-56103139 AGTTGCTTTCTGGGACTGCCTGG + Intergenic
933864728 2:86505816-86505838 TGTGGCCAGCCGGGACTGCATGG + Exonic
934774374 2:96927790-96927812 TGTGTCCTCCTGGGAGTGGGAGG - Intronic
935939858 2:108226949-108226971 TGTGAGCTCCTAGGACTGTCTGG + Intergenic
936051500 2:109227517-109227539 TGTGGGCTCCCGGGTCTGCCTGG + Intronic
936155436 2:110043693-110043715 TGCGGACACCTGAGACTGCCGGG - Intergenic
936189250 2:110327741-110327763 TGCGGACACCTGAGACTGCCGGG + Intergenic
937026305 2:118700460-118700482 TGTGGCCTCCTGGAGATGCCAGG - Intergenic
939153688 2:138501169-138501191 GGCGGCCTCCTGGGACCGCACGG - Intergenic
943534747 2:189133951-189133973 TGTGTCCTCCCTGGACTGCATGG - Intronic
945219574 2:207469917-207469939 TGTGACCTAGTGGCACTGCCAGG + Intergenic
947710803 2:232314424-232314446 TGAGGCCTCCGGGGCCTGCTCGG - Intronic
947755196 2:232557953-232557975 TGTGAGCTCGTGGGACGGCCGGG - Exonic
947915945 2:233831562-233831584 TGTGGCCACCTGGGACGGGCTGG - Intronic
948478160 2:238234531-238234553 TGAGCCCTTCCGGGACTGCCCGG - Intergenic
948514349 2:238494360-238494382 TGTGGCCTGCACGGGCTGCCGGG - Intergenic
948632733 2:239312401-239312423 TGTGGGCTCCTGGGCCAGCATGG - Intronic
948756105 2:240160562-240160584 TGTGGCCTCATGGTCCTGCGTGG + Intergenic
948771437 2:240253127-240253149 AGGTGCCTCCTGGGACAGCCTGG + Intergenic
1168747094 20:253002-253024 TGGGGCCTCATGGGAGTGTCTGG - Intergenic
1170484214 20:16799763-16799785 TGTGCCCTCCTAGGGATGCCCGG + Intergenic
1170709675 20:18779011-18779033 AGGGGCCTGCTGGGACTCCCTGG + Intergenic
1172162654 20:32879271-32879293 TGAGGCCTCCAGGGCCTGGCTGG - Intronic
1173021257 20:39269568-39269590 TGTATCCTCCTGGGCCTGCCTGG + Intergenic
1173226287 20:41164079-41164101 AGTGGACTGCTGGGACGGCCCGG + Exonic
1173616288 20:44405544-44405566 TGTGGCCTCCTAGGAGGGTCTGG - Intronic
1173648884 20:44650896-44650918 TGTGGCGTCTTGGGACTGTTGGG - Intronic
1174411492 20:50339530-50339552 TGGAGCCTCCTGGCTCTGCCTGG - Intergenic
1174509496 20:51040401-51040423 TGGGGGCTCCTGGGACTCCTTGG + Intergenic
1176026003 20:62985966-62985988 TGGGGCCCCGAGGGACTGCCTGG - Intergenic
1176069361 20:63218030-63218052 TGCTGCCTCCTGTGACTGGCTGG - Intergenic
1176155615 20:63618691-63618713 GATGGCAGCCTGGGACTGCCCGG + Intronic
1176230895 20:64032399-64032421 TGTGGCTTTCTAGGACAGCCTGG + Intronic
1176272978 20:64246163-64246185 AGTGGCCTTCTGGGCCTCCCTGG - Intergenic
1176872598 21:14095692-14095714 GCTCCCCTCCTGGGACTGCCAGG - Intergenic
1177015485 21:15782150-15782172 GGTGGCCGCATGGGGCTGCCCGG - Intronic
1178886095 21:36486030-36486052 TGTGGGCTCCCTGGCCTGCCAGG - Intronic
1179046280 21:37848073-37848095 TCTGGCCTCCAGGGACCTCCAGG - Intronic
1179408393 21:41143653-41143675 TCTGGGCTGCTGGGACTGCCAGG - Intergenic
1179605541 21:42513547-42513569 AGAGGCCGCCTGGGACTGCCCGG + Intronic
1179987878 21:44931476-44931498 TCTTGGCTCCTGGGACTGCGAGG - Intronic
1180061345 21:45386525-45386547 TGTGGCCTCCCCTGTCTGCCTGG - Intergenic
1181082850 22:20425783-20425805 TGTCGCCTCCTCGGGCAGCCCGG + Exonic
1182437659 22:30341052-30341074 CTTGGCCTCTTGGGACTGCCTGG - Intronic
1183343761 22:37295864-37295886 TGTGGCCTCCGGGTCCTGCATGG - Intronic
1183529809 22:38347295-38347317 TGTCACCTCCTGGGAGTGCCGGG - Intronic
1183606410 22:38868990-38869012 TGGGGCCTCCTGGGGCTGCTTGG + Intronic
1185215690 22:49598854-49598876 TTTGGCCTCATGGACCTGCCAGG - Intronic
949840303 3:8312868-8312890 TCTGGCCTCCTGAGCCTGCTAGG + Intergenic
950190003 3:10970062-10970084 TGTGGCCTCCTGGAAATTCCAGG - Intergenic
950289398 3:11771312-11771334 TGTGGCCTCCAGGGACGGGCTGG + Intergenic
950345631 3:12288841-12288863 TGTGGGCTCCTGCAAGTGCCAGG + Intronic
950466918 3:13161237-13161259 TGTGGCGTCCAGGGACCACCAGG + Intergenic
952980158 3:38727777-38727799 CTTGCCCTCCTGGGACTGACTGG - Intronic
953450641 3:43002496-43002518 TGTGGGCTCCTGGGGCTCCAAGG + Intronic
954325317 3:49860329-49860351 TGTGGCATCCAGGGACTACCAGG + Intronic
954745741 3:52786596-52786618 TGTGCCCTGGTGGGCCTGCCCGG - Intronic
954817160 3:53291809-53291831 TGAGGACTCCTGGAACTGCTGGG + Intronic
955015719 3:55066858-55066880 TGTGGCCTGGTGGGTTTGCCTGG - Intronic
960724100 3:120653062-120653084 TGTGGGCTCCTGACACTGCAGGG + Intronic
961471421 3:127115577-127115599 TGGAGCTTCCTGGGACCGCCAGG - Intergenic
962373013 3:134836145-134836167 TGTGGCCTCATGGGACTGGATGG - Intronic
962400652 3:135056285-135056307 CGTGGCCTCCTCTGCCTGCCAGG + Intronic
968230608 3:197002936-197002958 CGGGGCCTCCTGGGACGGCCTGG + Exonic
968555423 4:1244369-1244391 TGGTGCCCCCTGGGACTTCCTGG - Intronic
968832792 4:2941840-2941862 TGTGGCCACCTTGGCCGGCCAGG + Intronic
968903384 4:3441271-3441293 AGTGGACTCCTGGGTCTGTCTGG + Intergenic
969408711 4:7013688-7013710 TGTAGCCCCCTGGAAGTGCCAGG + Intronic
969500618 4:7550396-7550418 TGGAGCCTCCTGGGACTCCAAGG + Intronic
969923036 4:10558854-10558876 TATGGCCTCATGGGAAGGCCTGG + Intronic
970159227 4:13172342-13172364 TGTGGCGCCCTGGGATTGGCAGG - Intergenic
970194448 4:13541468-13541490 TGGTGCTGCCTGGGACTGCCAGG + Exonic
971677871 4:29657234-29657256 TTTGGCCTCCTGAGACTGTATGG + Intergenic
974011725 4:56613316-56613338 TGTGGTCTGCTAGGACTTCCAGG + Intergenic
976223958 4:82780797-82780819 TGGGGCCTCCTGGGGTGGCCAGG - Intronic
976300071 4:83508500-83508522 TGTGGCCTCGTGGGCCTGCAGGG + Intronic
981094220 4:140761633-140761655 TGACCACTCCTGGGACTGCCGGG - Intergenic
983484487 4:168317934-168317956 TGTGGCCTCATGGGACACCATGG - Intronic
983650001 4:170027610-170027632 TGCGGCAGCCTGGCACTGCCCGG - Intronic
985034067 4:185820722-185820744 TGTGAAGTCCCGGGACTGCCAGG - Intronic
985727011 5:1521997-1522019 AGTGGCCTCCGGGGACCTCCAGG + Intronic
985782261 5:1877596-1877618 TGAGGCCTCCTGGGCCTGTCGGG - Exonic
988066613 5:26233249-26233271 TGTGGCCTCCTGGGCTGCCCTGG + Intergenic
992615432 5:78542405-78542427 AATGGCTTCCTGGGACTTCCAGG + Intronic
997295273 5:132764942-132764964 TGTGTCCTTCTGGGAGTCCCAGG + Intronic
997358313 5:133278586-133278608 TATGGCCTTCTGGGACAGGCAGG - Intronic
997580191 5:135012183-135012205 AGTGGCCTGCTGGCAATGCCAGG + Intergenic
998092669 5:139380325-139380347 ATTGGCCTGCTGGGGCTGCCTGG - Exonic
1001780376 5:174363712-174363734 TGTGGGCTCCTGATAATGCCAGG - Intergenic
1001830696 5:174786725-174786747 TGTGGCCACTTGGGATTGGCTGG + Intergenic
1002532076 5:179853302-179853324 TGTGGCATGCTGGGACTCCCTGG + Intronic
1002620346 5:180483700-180483722 TGTGGCATCCTGGGACAGTCAGG + Intergenic
1005899633 6:30206275-30206297 TGGGATCTCCTGGGACAGCCTGG - Intronic
1006502291 6:34466466-34466488 AGTGGCATCCTGGCACTGCCTGG - Intronic
1006939415 6:37742137-37742159 TGTGGGCGTCTGGGACTGTCGGG - Intergenic
1007834658 6:44665281-44665303 TGCGGTCTCCGGGGGCTGCCTGG + Intergenic
1007929362 6:45676519-45676541 TGTGGCGCGTTGGGACTGCCTGG + Intergenic
1009694010 6:67072848-67072870 TGTTCCCTCCTGTAACTGCCAGG + Intergenic
1011529294 6:88302553-88302575 TCTGGTCTCCAGGGACTGGCTGG - Intergenic
1013791975 6:113847812-113847834 TGTGGTCTGCTGGGACAGACAGG - Intergenic
1015844049 6:137499098-137499120 TGTGCTATTCTGGGACTGCCTGG - Intergenic
1016754270 6:147666571-147666593 TGTGGCTTGCTGAGGCTGCCAGG - Intronic
1016859776 6:148705938-148705960 TGCAGGCTTCTGGGACTGCCTGG - Intergenic
1017924003 6:158895398-158895420 CGTGGCATCCTGGTACTGCTGGG + Intronic
1018711926 6:166503542-166503564 TGTGGCCTGGTGGGACCGACCGG - Intronic
1019208719 6:170386162-170386184 TGTGTCCTCCAGGGATTGGCGGG + Intronic
1019563490 7:1668981-1669003 TGTGGCCTCCTTCGGCTGGCTGG - Intergenic
1019614224 7:1951690-1951712 TGTGTCCTTCTGGGACTGGCCGG + Intronic
1020019710 7:4856212-4856234 ATCGGCCTCCTGGGACTGACAGG + Intronic
1023621183 7:42074703-42074725 TGTGGCCTCCTGGGACTGCCTGG - Intronic
1023869732 7:44256816-44256838 GGTGGGCACCTGGGACTCCCTGG + Intronic
1023931416 7:44708667-44708689 TGTGGGCTCCAGGTGCTGCCTGG - Exonic
1024242741 7:47448043-47448065 TGTGGACTGCTGGGACTGAAAGG + Intronic
1024256099 7:47540990-47541012 AGTGTCCTCCCAGGACTGCCAGG - Intronic
1024674296 7:51624141-51624163 TGTGGTCTCCTGGAATGGCCAGG + Intergenic
1026603996 7:71800338-71800360 GGGGGCTTCCTGGGGCTGCCTGG + Intronic
1026905156 7:74058701-74058723 TGTGGGCACCTGGGGCTGCCAGG - Intronic
1027482209 7:78712303-78712325 TGTGGCTTCCTCAGAGTGCCAGG - Intronic
1029495409 7:100893652-100893674 TTTGGCTTCCTGGCCCTGCCGGG - Exonic
1029608477 7:101614171-101614193 CGTGTCCTCCTGGGCCTGCAAGG + Intronic
1031963753 7:128012538-128012560 TGTGGACTCCTGGGAATGGGGGG - Intronic
1031976294 7:128095644-128095666 TCTGGCCTCCTCAGCCTGCCTGG + Intergenic
1035302878 7:157908482-157908504 AGTGGGCACCTGGCACTGCCAGG - Intronic
1035690089 8:1554414-1554436 TGTGGTGGCCTGGGACAGCCTGG + Intronic
1038798174 8:30727631-30727653 CGTGGCCTCCTATGACTACCTGG - Exonic
1039546505 8:38414662-38414684 TGTGCCCTCATGGCCCTGCCTGG - Intronic
1039956115 8:42208203-42208225 GGTGGCCTCCGGGGACTTTCCGG + Intergenic
1040829336 8:51660383-51660405 TGGGGCCTCCTGGTAATCCCTGG + Intronic
1041690234 8:60679918-60679940 TGGGGGCTCCTGGGGCTCCCCGG + Intronic
1043170500 8:76960032-76960054 TGTGGCCTCCTGGAGCAGCATGG + Intergenic
1048937766 8:139371033-139371055 TATGGGCTCCTGGGAATGCAGGG - Intergenic
1049059458 8:140264762-140264784 TTTGGCTTCCTTGGTCTGCCAGG - Intronic
1049256588 8:141617323-141617345 TCTGGCCTCCAGAGACTTCCAGG - Intergenic
1049607091 8:143534750-143534772 TGTGGCCACCAGGGACCGCATGG + Intronic
1049607960 8:143538479-143538501 CGAGGCCTCCCGGGCCTGCCTGG + Exonic
1049820801 8:144632043-144632065 CCTGCCCTCCTGGGTCTGCCAGG + Intergenic
1051416368 9:16845123-16845145 TGGGGCATCCTGGCAGTGCCTGG - Intronic
1055093457 9:72386424-72386446 TGTGGCTCTCTGGCACTGCCTGG + Intergenic
1055690488 9:78824778-78824800 TGTGGCCACCTAGGAGTGTCAGG + Intergenic
1056271978 9:84955421-84955443 TTTGGCCACCAGGAACTGCCTGG + Exonic
1057194981 9:93111772-93111794 TGCTGCCTCCTGGGGCCGCCAGG - Intronic
1057274387 9:93668581-93668603 TGTGGGCACCTGGGACTTGCAGG + Intronic
1057731589 9:97613655-97613677 TGTGGCATCATGGCACTGTCTGG + Intronic
1060222202 9:121770498-121770520 TGTGACCTCCTGGGACCACATGG - Intronic
1061013072 9:127966841-127966863 TGTGACCTGCAGCGACTGCCTGG - Intronic
1061022193 9:128023113-128023135 TGTGGCCTCCTGGGCAGCCCTGG - Intergenic
1061274035 9:129559152-129559174 GGTGGCCTCCTGGGCTGGCCGGG - Intergenic
1061292752 9:129661154-129661176 TCTGCCCTCCTGGGATTCCCTGG + Intergenic
1062049239 9:134438589-134438611 TGGGGCTTCCTGGCAGTGCCTGG - Intronic
1062165560 9:135105706-135105728 TGTGACCTCCTAGGTCTGCGTGG - Intronic
1062497909 9:136840276-136840298 TGTGGCTTCCTGTGACTCCATGG + Intronic
1062696167 9:137877529-137877551 AGTGGGCTCCGGGGACGGCCCGG + Intergenic
1203632581 Un_KI270750v1:82897-82919 TGCGGCCTCCTGTGCCTCCCTGG + Intergenic
1186202809 X:7171178-7171200 TTCGGCCTCCTGGGGCTGGCTGG + Intergenic
1189072944 X:37884076-37884098 TTGGGCCTCCTGGGCCTGTCAGG + Intronic
1192240464 X:69324005-69324027 TGGGGCTTCCACGGACTGCCTGG + Intergenic
1192632090 X:72785065-72785087 CCTGGCCTCCTGGGCCAGCCCGG - Intronic
1192649619 X:72935736-72935758 CCTGGCCTCCTGGGCCAGCCCGG + Intronic
1198932698 X:141878643-141878665 TGTGTCATCCTGGGGATGCCTGG - Intronic
1200001936 X:153066608-153066630 TGTGTCCTCCAGGGAGAGCCTGG - Intergenic
1200005796 X:153083417-153083439 TGTGTCCTCCAGGGAGAGCCTGG + Intergenic
1200060321 X:153481045-153481067 TGGGGCCTGCTGGGGCTGACAGG + Intronic
1200153430 X:153962818-153962840 TGAGGCCTTCGGGGACTGCTTGG - Intronic
1200251213 X:154555020-154555042 TGTGGCCTCTGCTGACTGCCTGG + Intronic