ID: 1023623681

View in Genome Browser
Species Human (GRCh38)
Location 7:42096278-42096300
Sequence TCTAGGGACCCTGACTCCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023623681_1023623685 -4 Left 1023623681 7:42096278-42096300 CCGATGGAGTCAGGGTCCCTAGA 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1023623685 7:42096297-42096319 TAGAATCCAGAATAGGACGCAGG 0: 1
1: 0
2: 0
3: 1
4: 79
1023623681_1023623687 28 Left 1023623681 7:42096278-42096300 CCGATGGAGTCAGGGTCCCTAGA 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1023623687 7:42096329-42096351 ACTCGCTTCCCCAGAAATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023623681 Original CRISPR TCTAGGGACCCTGACTCCAT CGG (reversed) Intronic
900325779 1:2108008-2108030 TCAAGGGAGCCTGCCTCCGTGGG + Intronic
900520668 1:3104120-3104142 TCGGGGGACCCTGTCTCCATGGG - Intronic
902851810 1:19164389-19164411 TCTGGGCACCCTGACTCCCATGG - Exonic
903741716 1:25562343-25562365 TCTAGGGCCCCTGCCTGCAAAGG - Intronic
904263869 1:29306717-29306739 TCCAGAGACCCTGACTACCTCGG - Intronic
905393628 1:37653411-37653433 ACTAGGGACCCTGGCTCCCTGGG - Intergenic
909560764 1:77006982-77007004 TCTTGGGACCCTGCCACCCTGGG - Intronic
917142780 1:171854187-171854209 TCTGTGGAGCCTGACTCCCTGGG + Intronic
919214459 1:194534558-194534580 TCTTGGGAACATAACTCCATTGG - Intergenic
922696197 1:227732203-227732225 TCTTGGGTCCCTGACCTCATTGG + Exonic
924331773 1:242946744-242946766 GCCAGGGTCCCTGCCTCCATGGG - Intergenic
1067744351 10:48924137-48924159 CCTAGGGACCCAGACTCCCTGGG - Intronic
1069712988 10:70501567-70501589 CCAAGGGACCCTGACCCCACGGG - Intronic
1069886618 10:71627817-71627839 TTGAGGGAGCATGACTCCATGGG - Intronic
1070470383 10:76773423-76773445 ACTAGGGACTCTAACCCCATGGG + Intergenic
1070568733 10:77624439-77624461 TCTAGGGACACAGGCCCCATTGG - Intronic
1071015870 10:80996838-80996860 TCCAGGGAACATAACTCCATTGG - Intergenic
1081186540 11:40049555-40049577 TGCAGGAACCCTGAATCCATTGG - Intergenic
1086860912 11:91923903-91923925 TCATGAGACACTGACTCCATGGG - Intergenic
1091385131 12:89121-89143 TCTAGGGACTCTCAGTCCTTAGG + Intronic
1091818872 12:3459526-3459548 TCCAGAGACCCTGACTCCGATGG - Intronic
1093943852 12:25085367-25085389 TCTGGGCAGCCTGACTCCAGGGG - Intronic
1094308829 12:29054400-29054422 TCTTGGAACCCTGAGTCCAAAGG + Intergenic
1102471014 12:113159942-113159964 GCGAGGCACCCTGGCTCCATTGG - Intronic
1104178157 12:126352317-126352339 TCTGGGGCACCTGACTCTATAGG - Intergenic
1110385586 13:74906878-74906900 ACTGGGCACCCCGACTCCATGGG - Intergenic
1120222184 14:81747041-81747063 CATAGGGACCCTGAATGCATAGG + Intergenic
1120378351 14:83740029-83740051 TAGAGAGACCCTGTCTCCATGGG + Intergenic
1121232644 14:92369030-92369052 TCTAAAGACCCTGCCTCCAGAGG + Intronic
1122180874 14:99953673-99953695 TCTTGGAAACCTGACTACATGGG - Intergenic
1123713640 15:23010471-23010493 AGTGGGGACCCTGACTCAATGGG + Intronic
1125412091 15:39416239-39416261 TACAGGGACCCTTACTCCAAAGG - Intergenic
1127401620 15:58592564-58592586 TCAAGGGAACCAGACTCCTTTGG - Exonic
1127625768 15:60778763-60778785 TCCAGGGATCCTGACTCAAAAGG - Intronic
1132695063 16:1198392-1198414 TCCAGGGACACTGACACCCTGGG - Intronic
1135926837 16:26702196-26702218 TCTGGGTACCCACACTCCATAGG - Intergenic
1138365087 16:56468936-56468958 TCTTGGGACCATGGCTCCATGGG - Intronic
1139386204 16:66573059-66573081 GCCAGGGACCCTGACACCATGGG + Intronic
1140842393 16:78852215-78852237 TCTAGTGACCCTCACTTCCTGGG + Intronic
1143279659 17:5743487-5743509 TCTACTGACCCTGACTCCAGAGG - Intergenic
1145215422 17:21047917-21047939 TCTAGGAACCATAATTCCATGGG - Intergenic
1150682852 17:67297150-67297172 TTTAGTGACCCTCACTCCCTGGG + Intergenic
1157684493 18:49631350-49631372 TCTAGGAAACCTGCCTCCACTGG + Intergenic
1157903292 18:51541824-51541846 TCTAGAGATGCTGACTTCATAGG + Intergenic
1158188302 18:54796537-54796559 TCTGGGCATCCTGACTCCAGGGG - Intronic
1158213618 18:55076890-55076912 TGTAGGGAAGCTGACTCCATTGG - Intergenic
1160374186 18:78398611-78398633 TCTCTGGACCTTGACTCCAGTGG + Intergenic
1162410819 19:10503925-10503947 TTAAGAGATCCTGACTCCATTGG + Intergenic
1167467578 19:49658340-49658362 TCTGGGGGCCCTGGCTCCTTGGG - Exonic
1168460816 19:56555891-56555913 TCTAGGGACCATGAATGAATAGG + Exonic
926679870 2:15654886-15654908 TGTGGGGCTCCTGACTCCATAGG - Intergenic
927485759 2:23487489-23487511 TCTGGGAACCCTGGCTGCATGGG + Intronic
930309007 2:49714286-49714308 TCTGGGCAGCCTGACTCCAGGGG + Intergenic
932511097 2:72292106-72292128 TCTAGAGATCCTGATTCCATAGG + Intronic
933610103 2:84425026-84425048 TATAGCCACCCTGACCCCATGGG - Intronic
937574094 2:123398047-123398069 TCTAGAGGTCCTGACTCAATAGG - Intergenic
941378746 2:164764567-164764589 TCAAGGAACCCTGATTCCTTTGG - Intronic
1172103053 20:32497249-32497271 TCCAGGAGACCTGACTCCATGGG - Intronic
1178252204 21:31014352-31014374 GGTTGGGACCCTAACTCCATAGG - Intergenic
1181334355 22:22117244-22117266 TCCAGGGAGCCTGGCTCCACAGG + Intergenic
1184527536 22:45034313-45034335 CCTGGGGACCCTGGCTCCACCGG + Intergenic
952495524 3:33912631-33912653 TCTACTGCCCCTGACTCCCTTGG + Intergenic
954434712 3:50489931-50489953 TCTTGGGACACTCAGTCCATGGG - Intronic
954963546 3:54589037-54589059 TCTAGGGACTGTGACTTCCTAGG - Intronic
965684962 3:171292887-171292909 TCTAGGGAGCCTGTGGCCATTGG - Intronic
966332802 3:178833901-178833923 TCAAGGGTCCCTGCCTCCCTTGG + Intronic
966876569 3:184325497-184325519 TCTTGGGACCCTGATCCCCTCGG - Exonic
968799737 4:2733982-2734004 TCCAGGGTCCCTGACTTGATGGG + Intergenic
970465128 4:16314974-16314996 TCTGGGGTCTCTGACTCCTTAGG - Intergenic
973532129 4:51844256-51844278 TCAAGGGACCCTGCCTCGACAGG - Intronic
978363248 4:107953630-107953652 TCTAAGGAACTTCACTCCATGGG - Intergenic
982352553 4:154431755-154431777 TCTAAGTTCCCAGACTCCATGGG + Intronic
994979176 5:106851158-106851180 TCTGGAGACTCTGATTCCATAGG - Intergenic
998467765 5:142359150-142359172 ACTAGGGACCCTGACTTCAGTGG - Intergenic
999838919 5:155403289-155403311 TCTTGGGAACATAACTCCATTGG + Intergenic
1001798637 5:174524057-174524079 TCTAGGGACTCTGATTACACTGG + Intergenic
1002686935 5:181020211-181020233 TCTAAGGACCCTGCCTCCTGGGG + Intergenic
1002714547 5:181218408-181218430 TCTAAGGGCCATGACTCCATGGG - Intergenic
1012104344 6:95135772-95135794 TCTAGGGACCTTCACTACAAGGG + Intergenic
1012556777 6:100522865-100522887 TCTGGGGAACCTGACTTCAAAGG + Intronic
1013355882 6:109345727-109345749 TCTCCGGCCTCTGACTCCATGGG + Intergenic
1015780865 6:136864006-136864028 GCTGGGGACCCAGACTCCTTGGG + Intronic
1022972534 7:35530793-35530815 TCTGAGAACCCTGACTCCACAGG + Intergenic
1023020342 7:36006484-36006506 TCTAACAACCCTGACTCCACGGG + Intergenic
1023623681 7:42096278-42096300 TCTAGGGACCCTGACTCCATCGG - Intronic
1034416878 7:150969975-150969997 TCTACTGACCCTGACTCCCATGG + Intronic
1039320502 8:36424991-36425013 CCAAGGGACCCTGAATCCTTGGG - Intergenic
1044847538 8:96397119-96397141 TCTAGTTACCCTGTCTCCCTGGG + Intergenic
1046699285 8:117381996-117382018 TTCAGGGAGCCTGACTCCAGAGG - Intergenic
1049112691 8:140657955-140657977 ACTAGGGACTCAGACTCCAAAGG - Intronic
1055341586 9:75290088-75290110 TATAGAGACCCAGACTCCCTTGG - Intergenic
1056120071 9:83478951-83478973 TCTAGGGACCCGTAGTGCATAGG - Intronic
1056958723 9:91103158-91103180 TTTAGAGACCCTGTCTCCAAAGG - Intergenic
1057853986 9:98588653-98588675 ACTCTGGAACCTGACTCCATGGG - Intronic
1062079680 9:134617254-134617276 TCTTGGGACCATCACTCCAGGGG + Intergenic
1187707881 X:22025493-22025515 GCTAGGCACCCCGACTCCAGGGG - Intergenic
1190758878 X:53423418-53423440 CTTAGGGACCCTGACTCCTGGGG - Intronic
1197882378 X:131180536-131180558 TCTAAGGATACTGACACCATGGG - Intergenic
1198483581 X:137063977-137063999 CCCAGGGAGCCTGACTCCAGAGG - Intergenic
1199314297 X:146359022-146359044 TCTATGCACACTGACTCCCTTGG - Intergenic
1200835416 Y:7727022-7727044 TCCAGGGACCCTGTCCCCCTTGG - Intergenic
1201229114 Y:11845909-11845931 GCCAGGGTCCCTGCCTCCATGGG - Intergenic