ID: 1023624893

View in Genome Browser
Species Human (GRCh38)
Location 7:42106196-42106218
Sequence GTGAGCAGCATGGAAACTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023624893_1023624897 24 Left 1023624893 7:42106196-42106218 CCCGCAGTTTCCATGCTGCTCAC 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1023624897 7:42106243-42106265 CCTCTGAGAGCACAGCCCAGAGG 0: 1
1: 0
2: 2
3: 30
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023624893 Original CRISPR GTGAGCAGCATGGAAACTGC GGG (reversed) Intronic
901311011 1:8269776-8269798 GGGACCAGCATGGACAATGCAGG - Intergenic
901490518 1:9594262-9594284 GTCAACAGCATGGAGACAGCGGG - Intronic
901776524 1:11563906-11563928 GCCAGCAGCAGGGAAACTGGTGG - Intergenic
906155601 1:43612263-43612285 GTGAGCAGCGTGGCAAGTGGGGG + Intronic
906810623 1:48823600-48823622 GTGAGCAGCAAGGAAGGGGCAGG - Intronic
908527835 1:65004390-65004412 GTGCTCTGCATAGAAACTGCTGG + Intergenic
909351442 1:74657942-74657964 GTGACCAGAATGGAAACTTCTGG + Intronic
909601872 1:77469465-77469487 GTGGGCAGGCTGGAAACTGTTGG - Intronic
910982213 1:92970006-92970028 GTGATCAGCAAGGAAACATCTGG - Intergenic
912251620 1:108017904-108017926 TTGAGCAGGATGGAAACTAGGGG + Intergenic
915011267 1:152688154-152688176 GAGAGAAGCAGGGAAACAGCAGG + Intergenic
918077596 1:181182303-181182325 GTTAGCAGCAGTGAATCTGCAGG - Intergenic
918720165 1:187842255-187842277 TTGAGCAACATGGATACAGCTGG - Intergenic
922586000 1:226735938-226735960 GTGTGCAGCCTGGGAACTCCAGG - Exonic
924457078 1:244227389-244227411 GTCAGCAACAAGGTAACTGCTGG + Intergenic
1063256398 10:4331969-4331991 TTTACCAGCATGGAAACTTCTGG + Intergenic
1064190837 10:13204259-13204281 GTGAGCAGCATGAATACCACTGG + Exonic
1064305621 10:14163686-14163708 GGGAGAAGCTTGGAAGCTGCTGG - Intronic
1065721296 10:28630752-28630774 TTTAGCAACATGGAAGCTGCAGG + Intergenic
1066307176 10:34156746-34156768 GAGAAGAGCATGGAAGCTGCAGG - Intronic
1068526156 10:58132582-58132604 ATGAGCATCATGGTCACTGCTGG + Intergenic
1068869240 10:61925979-61926001 GTGAGCAGGATGGAAAAGGTTGG + Intronic
1068929803 10:62577743-62577765 GTCAGCAGCTAGGAAGCTGCAGG + Intronic
1069769581 10:70888678-70888700 CTGAGCAGCGAGGAAAGTGCTGG - Exonic
1069942593 10:71965341-71965363 GTGAGCAGCGTGGAAGAGGCTGG + Intronic
1072695036 10:97596793-97596815 GTGAACAGCATGGAAAAAGTTGG + Intronic
1073734480 10:106330183-106330205 GAGAAGAGCATGGAAAATGCAGG - Intergenic
1074009384 10:109461173-109461195 GAGAGTAGCGTGGAAGCTGCTGG - Intergenic
1075416945 10:122271275-122271297 GTGAGCACCACGGCAACGGCAGG - Intergenic
1076092260 10:127697334-127697356 GTGAGAAGCATGGGGACAGCTGG - Intergenic
1076369959 10:129946148-129946170 GTGAGAAGCAGGGAATCCGCGGG - Intronic
1078511279 11:11986068-11986090 ATGAGAAGGATGGAATCTGCTGG + Intronic
1078935845 11:15949355-15949377 GTGAGCTCCATGGAAGCTGTAGG + Intergenic
1082698925 11:56403217-56403239 GTGAACAGCAAGGAACCTGCAGG - Intergenic
1083533316 11:63445389-63445411 GTGAAAAACATGGAAACTGGAGG - Intergenic
1086668782 11:89521115-89521137 GTGAATAGCATTGAAACTGTTGG - Intergenic
1089595778 11:119578949-119578971 GTTGGCAGCATGGAAAGGGCAGG + Intergenic
1089763374 11:120745134-120745156 GTGACCAGGATGAAAACTGGAGG - Intronic
1090218917 11:124997989-124998011 ATGAGGAACATGGAAACTGGGGG + Intronic
1090723973 11:129505145-129505167 GTGAGGAGCTTGGACACTCCAGG - Intergenic
1091213955 11:133888199-133888221 GTCAGCAGCATGGCAGCAGCAGG - Intergenic
1091519427 12:1221433-1221455 TTAATCAGCAAGGAAACTGCAGG - Intronic
1099908889 12:88805785-88805807 GTGAGCACAATGCAAACTGGGGG + Intergenic
1099953415 12:89328804-89328826 GTGAGCCTCAGGGAATCTGCTGG - Intergenic
1100241982 12:92718817-92718839 CAGAGCACCATGGTAACTGCTGG - Intergenic
1100864528 12:98842741-98842763 GTGAGCAACATATACACTGCAGG + Intronic
1101180350 12:102210176-102210198 TTTAGCAACATGGAAACAGCTGG + Intergenic
1104284995 12:127417187-127417209 GTGAGCAGCATGGGAATGGCTGG - Intergenic
1106801931 13:33264681-33264703 TTGAGAAGCCTGGAAACTTCCGG + Intronic
1107875517 13:44787644-44787666 GTGGGCAGCCTGGAACTTGCAGG - Intergenic
1107892375 13:44925376-44925398 GTGAAAAGCAGGAAAACTGCAGG - Intergenic
1108744811 13:53381955-53381977 TTGAGCAGCATGTTAACTGTAGG + Intergenic
1111978329 13:94990985-94991007 GTCGGCAGCATGGAAACCACAGG - Intergenic
1114138309 14:19879971-19879993 CTGAGCCGCATGCAACCTGCAGG - Intergenic
1114621564 14:24099248-24099270 GTGAGAAGCAGGGCAGCTGCCGG + Intronic
1116617144 14:47154359-47154381 GTGCACTCCATGGAAACTGCGGG + Intronic
1120389269 14:83885147-83885169 GTGAACAGCATGAGAACTGGAGG + Intergenic
1121716604 14:96080678-96080700 TGGAGCAGCATGGAGACTGTTGG + Intronic
1125473781 15:40030146-40030168 GAGAGAAGCATCAAAACTGCTGG + Intronic
1127252328 15:57253338-57253360 GTGACCAGCAGGCAAACTGGTGG - Exonic
1127867911 15:63047031-63047053 AGGAGCAGCCAGGAAACTGCTGG - Intronic
1132808167 16:1785347-1785369 CTGAGCACCATGGTAAATGCAGG - Intronic
1133073550 16:3262930-3262952 CTGAGCAGCTTGGAAACGGAGGG + Intergenic
1133522355 16:6571301-6571323 GGGAGGAGCAAGGAAGCTGCAGG + Intronic
1133728654 16:8559742-8559764 GTCGGCAGCATCGCAACTGCAGG - Intergenic
1136895911 16:33995879-33995901 GTCAGCAGCATGGCCACAGCAGG - Intergenic
1138191507 16:55017500-55017522 GAGGGCAGCATGGAAGCTCCTGG + Intergenic
1142247817 16:88977764-88977786 GTGAGCAGCCTGGAGTTTGCGGG + Intergenic
1142270779 16:89088370-89088392 ATGAGCCCCCTGGAAACTGCTGG - Intronic
1142816876 17:2433412-2433434 GTGAGCAGGATGCTGACTGCAGG + Intronic
1144686510 17:17229514-17229536 GAGAGCAGAATGGCAGCTGCCGG + Intronic
1144734117 17:17545354-17545376 GTGAGGAGCATGCAACGTGCTGG - Intronic
1146159675 17:30553172-30553194 GTGGACACCATTGAAACTGCCGG + Intergenic
1146838010 17:36127730-36127752 ATGAGAAGGATGGAAAATGCAGG - Intergenic
1147164281 17:38585207-38585229 GAGAGGAGCATGGAGACAGCTGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148461763 17:47843203-47843225 GTGGGAAGCCGGGAAACTGCAGG - Intergenic
1150242375 17:63645342-63645364 ATGAGTAGCCTGTAAACTGCAGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150540745 17:66096278-66096300 ATGATCATCATGGAAACTGCTGG + Exonic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151519225 17:74616507-74616529 GGGAGCAGCCTGGAAGCTGATGG + Intronic
1151984755 17:77535054-77535076 GAGAGAAGCATGGAAACTCCAGG - Intergenic
1153069743 18:1091637-1091659 GTGAGAAGGAAGGAAACGGCAGG - Intergenic
1153652134 18:7250188-7250210 GTGAGCTGGATTGAATCTGCAGG - Intergenic
1157526761 18:48389113-48389135 GTGAGTAGCAGGGTAACTGCAGG + Intronic
1157995014 18:52544639-52544661 GTGAGCAGAAAGGAAACTTGTGG + Intronic
1158277147 18:55780587-55780609 CTGAGCCGCAGGGAAGCTGCGGG - Intergenic
1158984724 18:62802234-62802256 GGGAGGAGCATGGAGTCTGCAGG + Intronic
1159327418 18:66940977-66940999 GTGAGCAGATTAGAAAATGCTGG - Intergenic
1160310025 18:77780471-77780493 GAGAGCAGCAAGCACACTGCTGG - Intergenic
1161811690 19:6475251-6475273 GTGAGCAGCGGGGACGCTGCGGG - Intronic
1162592432 19:11601126-11601148 GTGAGCAGCTGGGACACTGCAGG - Intronic
1162648743 19:12068948-12068970 GTGAGCAGCTGGGACACTGCAGG - Intronic
1165782183 19:38441229-38441251 GGGAGGAGCAGGGAAACTGAGGG + Intronic
926076718 2:9948956-9948978 GTGAGCAGTAAGGGAAGTGCTGG + Intergenic
929599366 2:43195331-43195353 GTGAACTGCATTGACACTGCAGG + Intergenic
930052959 2:47230606-47230628 GTTTGCACCATGGAAACTCCAGG + Intergenic
935100544 2:99991073-99991095 GTGAGCAGCATGGTATCTTTGGG - Intronic
936153397 2:110033612-110033634 GTGAGCAGCTTGGGAGCAGCTGG + Intergenic
936191284 2:110337803-110337825 GTGAGCAGCTTGGGAGCAGCTGG - Intergenic
938322308 2:130373296-130373318 GTGCGCAGAATGGAAACAGTGGG + Exonic
938468341 2:131537008-131537030 GTCAGCAGCATGGAACCCGAGGG + Intergenic
938683116 2:133712201-133712223 GTGAGCAACATGAAAAGTACTGG + Intergenic
940050888 2:149463512-149463534 GTGACCAGAAGTGAAACTGCTGG - Intronic
944153946 2:196592227-196592249 GTGGACAGCATGCAAACTTCGGG - Intronic
946157267 2:217815228-217815250 GAGAGCACCATGGAAGGTGCAGG + Intronic
946192721 2:218016006-218016028 GTGAGATGAATGGAAAGTGCAGG + Intergenic
948767738 2:240232215-240232237 GTGAGCAGCAAGGAATCGACGGG + Intergenic
1168984005 20:2032068-2032090 GTGAGCAGCAGGGAAACAGCAGG - Intergenic
1169220617 20:3820343-3820365 GTGACCAGCATGGTCCCTGCCGG + Intergenic
1169870342 20:10242050-10242072 GTGCGCACCATGGGAGCTGCTGG + Intronic
1170628166 20:18045164-18045186 GTAAGCAGGATGGGGACTGCCGG - Intronic
1180059107 21:45375555-45375577 GGGAGGAGCAGGGACACTGCAGG + Intergenic
1180061455 21:45387241-45387263 GAGAGCTGCATGGAAGCTCCTGG - Intergenic
1181022219 22:20109546-20109568 GGGAGCAGCAAGGGACCTGCTGG - Intronic
1181333245 22:22111060-22111082 GTGAGCAGCAGGGGCACTGTGGG + Intergenic
1181857475 22:25792429-25792451 GTGAACCTCATGGAGACTGCAGG - Intronic
1182350627 22:29697359-29697381 GGGAGCAGGCTGGGAACTGCAGG + Exonic
1183875275 22:40775181-40775203 AAGAGCAGCAGGGAAACTGTAGG - Intronic
1183945388 22:41322987-41323009 GAGAGCAGCATGGATACCGAGGG - Intronic
1183978221 22:41525349-41525371 GTCAGCAGCATGGGGACGGCAGG + Intronic
1184539172 22:45108457-45108479 GTGATGAGAATGGAAACTTCAGG + Intergenic
950566184 3:13771028-13771050 GTGAGCAGGAGGGAGACTGGAGG - Intergenic
953465846 3:43118815-43118837 GTGAGCAGCCTTGCCACTGCTGG + Intergenic
954704745 3:52473423-52473445 GTGTGGGTCATGGAAACTGCTGG - Intronic
956756074 3:72388283-72388305 GTGAGCACCACGGCAGCTGCTGG + Intronic
956856249 3:73277658-73277680 TTCAGTAGCATGGAAAATGCAGG + Intergenic
961673751 3:128552520-128552542 GAGATCACCATGGGAACTGCTGG - Intergenic
963300415 3:143591376-143591398 GTGTGAAGCATGGGAACTGCAGG + Intronic
969597063 4:8155508-8155530 AAGAGCAGCATGGAAACAGAAGG + Intronic
972359803 4:38316317-38316339 GTCAACAGCATGGAGACTGCAGG + Intergenic
973345689 4:49052289-49052311 GTGAACAGCTTGGTAACTGTGGG + Intronic
973664351 4:53141902-53141924 GTGGGCAGCATCCAAACAGCTGG - Intronic
976874293 4:89836013-89836035 GTTAGAAGCATGGAAGCTGGAGG + Intronic
979431600 4:120639292-120639314 GTGAGCAGTATGGAAGCTTCTGG + Intergenic
981173777 4:141656230-141656252 GTCAGCAGCATGGAACATGATGG - Exonic
982207261 4:153006048-153006070 GCAGGCAGCATGGAAACTGGTGG + Intergenic
982266010 4:153538894-153538916 GGCAGCAGTTTGGAAACTGCCGG + Intronic
982741522 4:159061848-159061870 AGGAGCACCATGGAAACTGGAGG + Intergenic
984410507 4:179391693-179391715 TTGAGCAGCATGGCATCTTCTGG + Intergenic
985306717 4:188550507-188550529 GTCATCAGCAAGGAAACTGCAGG + Intergenic
986524755 5:8662187-8662209 GTGGGCACCATCGAATCTGCTGG + Intergenic
986697856 5:10374474-10374496 GTGGGCTGCCTGGATACTGCTGG + Intronic
988968673 5:36444625-36444647 GTGAGCTGCAGGGCAACTCCAGG - Intergenic
992941224 5:81764324-81764346 GTGAGTAGCATGGGATCTGGAGG - Intergenic
992988314 5:82256849-82256871 GTAAGCAGCATAGATACTGTGGG - Intronic
996422989 5:123282651-123282673 GAGAACAGCATGGAATCAGCTGG - Intergenic
996464633 5:123785480-123785502 GTCAGCAACATGAAACCTGCAGG + Intergenic
1001579383 5:172788633-172788655 GTGTGCAGCCTGGACACTGCAGG + Intergenic
1001924315 5:175625326-175625348 GTGAGCAGCAAGGACGCTGTTGG - Intergenic
1002492169 5:179586397-179586419 GTGTCCAGCAAGGAGACTGCCGG - Intronic
1003356911 6:5382016-5382038 GTGGGCAGCATGGGTCCTGCGGG + Intronic
1003424942 6:5992777-5992799 GTGTCCCGAATGGAAACTGCAGG + Intergenic
1004515751 6:16321144-16321166 GTTAGCTGCTTGGAAAATGCAGG - Intronic
1004959960 6:20776905-20776927 GGGAGCAGCAAAGAAGCTGCTGG - Intronic
1010760267 6:79714494-79714516 CTGAGCAGCATGGAAAGCCCAGG - Intergenic
1011007928 6:82668907-82668929 ATGAGCAGCATGGTAACCCCTGG + Intergenic
1013630799 6:111984203-111984225 GTGAGCAGCATGGCCAAGGCAGG + Intergenic
1014415936 6:121184645-121184667 ATGACCAGCATTGAACCTGCTGG - Intronic
1017097014 6:150813429-150813451 CTCAGCAGCTTGGAAACTACTGG + Intronic
1017297498 6:152815659-152815681 GTGACAAGCATGGAATATGCTGG + Intergenic
1017986792 6:159450809-159450831 GTAACAAGCAAGGAAACTGCAGG + Intergenic
1018452920 6:163925573-163925595 GTGAACAGCAGGCAAACTGCAGG + Intergenic
1018977233 6:168574759-168574781 GAGACCAGCATGGAATGTGCCGG - Intronic
1019317600 7:396744-396766 GTGAGCAGGATGCATACTGCAGG - Intergenic
1019576448 7:1739862-1739884 GGGAGGGGGATGGAAACTGCTGG + Intronic
1020106387 7:5424056-5424078 GAGGGGAGCCTGGAAACTGCTGG - Intronic
1023584059 7:41710482-41710504 GTGAGCCGCATAGAATGTGCTGG + Intergenic
1023624893 7:42106196-42106218 GTGAGCAGCATGGAAACTGCGGG - Intronic
1023897005 7:44442413-44442435 GGCACCAGCATGGAGACTGCAGG + Intronic
1024254045 7:47526725-47526747 ATGAGCAGCATGGCATCAGCAGG - Intronic
1025015643 7:55436943-55436965 GTGAGCAGCAGCGTATCTGCTGG - Intronic
1027266846 7:76499201-76499223 GTGACCTGGAGGGAAACTGCTGG - Intronic
1027318663 7:76999061-76999083 GTGACCTGGAGGGAAACTGCTGG - Intergenic
1027728244 7:81834949-81834971 GTGAGCAGCATGGAGGTTGATGG - Intergenic
1029424380 7:100487014-100487036 GTGGGCAGCATGGACAGTGTCGG + Exonic
1029977494 7:104848590-104848612 GTGACCAAATTGGAAACTGCAGG + Intronic
1030359346 7:108579319-108579341 GTGCGCTCCATGGAGACTGCAGG + Intergenic
1031305872 7:120126733-120126755 GTCAACAGCATGAAAAATGCAGG + Intergenic
1033536516 7:142317308-142317330 CTGAGAAGCATGGTCACTGCAGG - Intergenic
1033722638 7:144077935-144077957 GTAAGCAGCTTGTAAGCTGCGGG + Intergenic
1033864292 7:145669540-145669562 TTGAGCAACATGGAAAGTGCTGG + Intergenic
1034100287 7:148445196-148445218 GTGGGCAGCATGGGGACTGGCGG - Intergenic
1034259392 7:149745345-149745367 GTGAGCAGCAAGGGAAGGGCCGG + Intergenic
1037382099 8:18296655-18296677 TTGAGCAACATGGACACAGCTGG - Intergenic
1037893536 8:22636808-22636830 GTGAGCACCCTGGAAGCTGAGGG - Intronic
1040293514 8:46137500-46137522 GTGAGAAGCAGAGAGACTGCAGG - Intergenic
1040307941 8:46221939-46221961 GGGAGAAGCATGGAGACAGCAGG + Intergenic
1040315162 8:46257122-46257144 GGGAGAAGCAGGGAGACTGCAGG + Intergenic
1041318580 8:56590449-56590471 AGGAGCAGCTTGGAAACTACAGG - Intergenic
1045638266 8:104218361-104218383 ATGAGGAGAATGCAAACTGCTGG - Intronic
1047650191 8:126912126-126912148 GTGATCAGCATGGTGACTGCTGG + Intergenic
1048561609 8:135544602-135544624 TTGAGTTGCATGGAGACTGCTGG + Intronic
1048988712 8:139748963-139748985 GTGTGCAGCAGGGAGACAGCAGG + Intronic
1049343034 8:142123957-142123979 GAGAGCAGCAAGGAAAGGGCAGG + Intergenic
1049809777 8:144561181-144561203 GTGAGTCCGATGGAAACTGCTGG - Intronic
1050884057 9:10741527-10741549 ATGAACAGCATAGAAACTGCAGG - Intergenic
1052603603 9:30671277-30671299 GGGAGCAGCATGGGAGCTGCTGG + Intergenic
1056931419 9:90880957-90880979 TTGGGCAGCATGGCAGCTGCGGG + Intronic
1057014840 9:91642458-91642480 GTGAACTCCATGGAAACTTCTGG - Intronic
1057840569 9:98482807-98482829 GAGAGCAGCATGGAAGCCACCGG - Intronic
1061008891 9:127943775-127943797 GTGAGCAAGAAGGAAACTGAGGG - Intronic
1061482623 9:130904501-130904523 GTGAGCTGCATGGACACACCCGG - Intronic
1061936267 9:133859191-133859213 GTGAGGACCATGGAAAGGGCTGG - Intronic
1062485552 9:136773381-136773403 GGGAGTGGCCTGGAAACTGCTGG + Intergenic
1186422609 X:9438351-9438373 CTGAGCACCATGAAAACTGAGGG + Intergenic
1186654651 X:11599701-11599723 GTGGGTAGCATGGTAACTACAGG + Intronic
1187398389 X:18937837-18937859 GTGAGAAGAATGGAAACAGCAGG + Intronic
1187719820 X:22138843-22138865 TAGACCAGCATGGAAACCGCGGG + Intronic
1188505855 X:30884102-30884124 GAGAGCAGTATGTTAACTGCTGG - Intronic
1195045297 X:101049997-101050019 GTCAGGAGGAAGGAAACTGCAGG + Intronic
1195598693 X:106722101-106722123 GGGAGTAGCATGGAAACTCTGGG + Intronic
1198276595 X:135099838-135099860 CTGAGCATCAAGGAAACTGAAGG + Intergenic
1200817905 Y:7552969-7552991 GTCAGCAGTCTGGAACCTGCAGG + Intergenic