ID: 1023629107

View in Genome Browser
Species Human (GRCh38)
Location 7:42145911-42145933
Sequence AGGAATCCTTTCCTCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023629107_1023629112 2 Left 1023629107 7:42145911-42145933 CCCACAGTGAGGAAAGGATTCCT 0: 1
1: 0
2: 3
3: 19
4: 328
Right 1023629112 7:42145936-42145958 AGGGATCAGCACACTTGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 111
1023629107_1023629113 30 Left 1023629107 7:42145911-42145933 CCCACAGTGAGGAAAGGATTCCT 0: 1
1: 0
2: 3
3: 19
4: 328
Right 1023629113 7:42145964-42145986 CAGCTAGCAAGTGACAAAGCTGG 0: 2
1: 10
2: 73
3: 390
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023629107 Original CRISPR AGGAATCCTTTCCTCACTGT GGG (reversed) Intronic