ID: 1023629107 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:42145911-42145933 |
| Sequence | AGGAATCCTTTCCTCACTGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 351 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 19, 4: 328} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1023629107_1023629112 | 2 | Left | 1023629107 | 7:42145911-42145933 | CCCACAGTGAGGAAAGGATTCCT | 0: 1 1: 0 2: 3 3: 19 4: 328 |
||
| Right | 1023629112 | 7:42145936-42145958 | AGGGATCAGCACACTTGTCAAGG | 0: 1 1: 0 2: 1 3: 14 4: 111 |
||||
| 1023629107_1023629113 | 30 | Left | 1023629107 | 7:42145911-42145933 | CCCACAGTGAGGAAAGGATTCCT | 0: 1 1: 0 2: 3 3: 19 4: 328 |
||
| Right | 1023629113 | 7:42145964-42145986 | CAGCTAGCAAGTGACAAAGCTGG | 0: 2 1: 10 2: 73 3: 390 4: 1482 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1023629107 | Original CRISPR | AGGAATCCTTTCCTCACTGT GGG (reversed) | Intronic | ||