ID: 1023629108

View in Genome Browser
Species Human (GRCh38)
Location 7:42145912-42145934
Sequence TAGGAATCCTTTCCTCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023629108_1023629113 29 Left 1023629108 7:42145912-42145934 CCACAGTGAGGAAAGGATTCCTA No data
Right 1023629113 7:42145964-42145986 CAGCTAGCAAGTGACAAAGCTGG 0: 2
1: 10
2: 73
3: 390
4: 1482
1023629108_1023629112 1 Left 1023629108 7:42145912-42145934 CCACAGTGAGGAAAGGATTCCTA No data
Right 1023629112 7:42145936-42145958 AGGGATCAGCACACTTGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023629108 Original CRISPR TAGGAATCCTTTCCTCACTG TGG (reversed) Intronic