ID: 1023629108 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:42145912-42145934 |
Sequence | TAGGAATCCTTTCCTCACTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1023629108_1023629113 | 29 | Left | 1023629108 | 7:42145912-42145934 | CCACAGTGAGGAAAGGATTCCTA | No data | ||
Right | 1023629113 | 7:42145964-42145986 | CAGCTAGCAAGTGACAAAGCTGG | 0: 2 1: 10 2: 73 3: 390 4: 1482 |
||||
1023629108_1023629112 | 1 | Left | 1023629108 | 7:42145912-42145934 | CCACAGTGAGGAAAGGATTCCTA | No data | ||
Right | 1023629112 | 7:42145936-42145958 | AGGGATCAGCACACTTGTCAAGG | 0: 1 1: 0 2: 1 3: 14 4: 111 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1023629108 | Original CRISPR | TAGGAATCCTTTCCTCACTG TGG (reversed) | Intronic | ||