ID: 1023629111

View in Genome Browser
Species Human (GRCh38)
Location 7:42145931-42145953
Sequence ACAAGTGTGCTGATCCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023629111_1023629113 10 Left 1023629111 7:42145931-42145953 CCTAGAGGGATCAGCACACTTGT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1023629113 7:42145964-42145986 CAGCTAGCAAGTGACAAAGCTGG 0: 2
1: 10
2: 73
3: 390
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023629111 Original CRISPR ACAAGTGTGCTGATCCCTCT AGG (reversed) Intronic