ID: 1023629112

View in Genome Browser
Species Human (GRCh38)
Location 7:42145936-42145958
Sequence AGGGATCAGCACACTTGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023629106_1023629112 7 Left 1023629106 7:42145906-42145928 CCTATCCCACAGTGAGGAAAGGA 0: 1
1: 0
2: 1
3: 46
4: 598
Right 1023629112 7:42145936-42145958 AGGGATCAGCACACTTGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 111
1023629107_1023629112 2 Left 1023629107 7:42145911-42145933 CCCACAGTGAGGAAAGGATTCCT 0: 1
1: 0
2: 3
3: 19
4: 328
Right 1023629112 7:42145936-42145958 AGGGATCAGCACACTTGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 111
1023629104_1023629112 8 Left 1023629104 7:42145905-42145927 CCCTATCCCACAGTGAGGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 221
Right 1023629112 7:42145936-42145958 AGGGATCAGCACACTTGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 111
1023629108_1023629112 1 Left 1023629108 7:42145912-42145934 CCACAGTGAGGAAAGGATTCCTA No data
Right 1023629112 7:42145936-42145958 AGGGATCAGCACACTTGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023629112 Original CRISPR AGGGATCAGCACACTTGTCA AGG Intronic