ID: 1023629113

View in Genome Browser
Species Human (GRCh38)
Location 7:42145964-42145986
Sequence CAGCTAGCAAGTGACAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1957
Summary {0: 2, 1: 10, 2: 73, 3: 390, 4: 1482}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023629108_1023629113 29 Left 1023629108 7:42145912-42145934 CCACAGTGAGGAAAGGATTCCTA No data
Right 1023629113 7:42145964-42145986 CAGCTAGCAAGTGACAAAGCTGG 0: 2
1: 10
2: 73
3: 390
4: 1482
1023629111_1023629113 10 Left 1023629111 7:42145931-42145953 CCTAGAGGGATCAGCACACTTGT 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1023629113 7:42145964-42145986 CAGCTAGCAAGTGACAAAGCTGG 0: 2
1: 10
2: 73
3: 390
4: 1482
1023629107_1023629113 30 Left 1023629107 7:42145911-42145933 CCCACAGTGAGGAAAGGATTCCT 0: 1
1: 0
2: 3
3: 19
4: 328
Right 1023629113 7:42145964-42145986 CAGCTAGCAAGTGACAAAGCTGG 0: 2
1: 10
2: 73
3: 390
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023629113 Original CRISPR CAGCTAGCAAGTGACAAAGC TGG Intronic