ID: 1023630276

View in Genome Browser
Species Human (GRCh38)
Location 7:42156814-42156836
Sequence CTGGTGATGGGAGGAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1331
Summary {0: 1, 1: 0, 2: 9, 3: 136, 4: 1185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023630276 Original CRISPR CTGGTGATGGGAGGAGGGTG TGG (reversed) Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900122765 1:1055962-1055984 GTGGGGATGGGATGGGGGTGGGG - Exonic
900243019 1:1625792-1625814 CTGGTGGGTGGAGGTGGGTGGGG + Intronic
900361581 1:2291629-2291651 AAGGTGCTGGAAGGAGGGTGGGG - Intronic
900388043 1:2419548-2419570 CTGGGGATGTGAGGCCGGTGAGG + Intergenic
900503380 1:3017307-3017329 CCGGGGATGGGAGGTGGGTGGGG + Intergenic
900574633 1:3376995-3377017 CTTGTGATGGAAGGAGGTGGGGG - Intronic
900700799 1:4047543-4047565 ATGGGGAAGGGAGGAGGGGGAGG + Intergenic
900734319 1:4286171-4286193 TGGGGGCTGGGAGGAGGGTGAGG - Intergenic
900839647 1:5038008-5038030 CAGGAGATGGGAGGAGGAGGAGG - Intergenic
900870122 1:5296391-5296413 CTGTGCATGGGAGGAGGCTGCGG + Intergenic
900942715 1:5811403-5811425 GTGCTGATGGGCGGGGGGTGGGG - Intergenic
901082189 1:6589706-6589728 CTGGGGGTCTGAGGAGGGTGGGG + Intergenic
901199237 1:7457417-7457439 CAGGTGAGGGGAGGTGGGTGGGG + Intronic
901202930 1:7476798-7476820 CTGGTGACAGGATGAGGATGAGG - Intronic
901556316 1:10033687-10033709 CTGATGAGGTGAGGAGGTTGGGG + Exonic
901784761 1:11617262-11617284 GTGGGGAGGGGAGCAGGGTGTGG - Intergenic
901836966 1:11930428-11930450 GTGGAGACGGGAGGTGGGTGGGG + Intergenic
902048885 1:13546272-13546294 CAGGTGATGGGAGAAGGAGGGGG + Intergenic
902120444 1:14160430-14160452 CTGCTGCAGGGAGGAGGGTGAGG + Intergenic
902298696 1:15486091-15486113 CTGGGGATGGGAAGAGGCTATGG + Intronic
902429685 1:16353252-16353274 TTGGTGTTGGGGGGGGGGTGGGG - Intronic
902448747 1:16483957-16483979 CAGGTGGAGGGAGGAGGCTGCGG - Intergenic
902506032 1:16939402-16939424 CTGGTGGAGGGAGGAGGCTGCGG + Intronic
903033131 1:20477471-20477493 ATGGTGATGGCAGTGGGGTGGGG - Intergenic
903142542 1:21347594-21347616 ATGGTGAAGGGGGGAGGGTCTGG + Intergenic
903155014 1:21437061-21437083 CTGGTGGAAGGAGGAGGCTGCGG + Intergenic
903499652 1:23794134-23794156 CAGGTGAGGGGAGAGGGGTGGGG + Exonic
903645895 1:24896397-24896419 ATGGTGATGGGAGGTGGGAGAGG - Intergenic
903836051 1:26203888-26203910 ATGCTGATGGGAGGACGATGGGG - Intergenic
904359849 1:29964170-29964192 ATGGGGTTGGGAGGAGGGAGAGG + Intergenic
904384284 1:30131430-30131452 CAGGGGATGGGAGGAGAGAGAGG + Intergenic
904403397 1:30271542-30271564 CTGGTGTTGGGTGGAGGGTGGGG + Intergenic
904421690 1:30398372-30398394 CTGGGGATTGAAGGAGAGTGAGG + Intergenic
904421727 1:30398479-30398501 CTGGGGATTGAAGGAGAGTGAGG + Intergenic
904617679 1:31758718-31758740 TGGGTCTTGGGAGGAGGGTGGGG - Intronic
905442856 1:38005741-38005763 CTGGGGATGGGGGGTGGGAGGGG - Intergenic
905538697 1:38743451-38743473 CTGATGATGGGAGGGCAGTGTGG - Intergenic
905546930 1:38807531-38807553 CTGGAGATGGGAGGTTGGAGGGG - Intergenic
905587956 1:39136374-39136396 CTGGACATGGGTGGAGGGTGAGG + Intronic
905807696 1:40888754-40888776 CTGGGTAGGGGAGGAAGGTGAGG - Intergenic
905856745 1:41319572-41319594 CTGGGGATGCCAAGAGGGTGGGG + Intergenic
906110483 1:43318938-43318960 CAGGGGATGGGAAGAGGGAGGGG + Intronic
906126296 1:43428895-43428917 CTGTTGAAGGGAGGAAGGGGAGG + Intronic
906748815 1:48240748-48240770 CTGTTGAAGGGAGGAGAGGGAGG - Intronic
907312032 1:53544318-53544340 CTGGAGATGGGAGAAGGGGAAGG + Intronic
907410495 1:54280088-54280110 ATGGTGGTGGGAGGAGAGAGAGG - Intronic
908880581 1:68727279-68727301 CTGGAGATGGGAGGAGGGAGAGG - Intergenic
908926790 1:69265475-69265497 CAGAGGATGGGAGGAGGGAGAGG - Intergenic
909430949 1:75587245-75587267 AGGGTGATGGGAGAAGGGTTAGG - Intronic
910114466 1:83716902-83716924 GTGGTGGTGAGGGGAGGGTGGGG - Intergenic
910545961 1:88419363-88419385 CTGGTAGTGGGAGGTGGGGGTGG + Intergenic
910632908 1:89374925-89374947 CTGGGGATTAGGGGAGGGTGTGG - Intronic
910812669 1:91253948-91253970 CTGGTGATGAGCAGAGGATGTGG - Intergenic
911161796 1:94688858-94688880 CTGGAGGCGGGAGGAGAGTGAGG - Intergenic
911674489 1:100643915-100643937 GTGGTGATTGGAGGAGAGTTGGG + Intergenic
911769675 1:101724397-101724419 CGGGGGAAGGGAGGAGGATGTGG + Intergenic
911881956 1:103251227-103251249 CTGTTGTTGGGTGGAGGGAGGGG + Intergenic
912016902 1:105050168-105050190 CTGGGGAGGGGAGGAGGGAAGGG - Intergenic
913052701 1:115131106-115131128 CTGGCACTGGGATGAGGGTGGGG + Intergenic
913122381 1:115753843-115753865 TTGTTGAAGGGAGGTGGGTGGGG + Intronic
913269020 1:117074671-117074693 CTGGAGAGGGGAGGAGGGCATGG + Intronic
913366009 1:118039642-118039664 TTGAGGGTGGGAGGAGGGTGAGG + Intronic
914264731 1:146028637-146028659 CTGGTGATGGCCAGAGGCTGAGG - Intergenic
914676101 1:149908593-149908615 AGGGTGATGAGAGAAGGGTGGGG - Intronic
915108163 1:153547045-153547067 CTCATGGTTGGAGGAGGGTGGGG - Intronic
915473648 1:156139890-156139912 GGGGTGCTGGGAGGAGGGAGAGG + Exonic
915506003 1:156356955-156356977 CTGGGGGAGGGAGCAGGGTGGGG - Intronic
915517922 1:156423939-156423961 CTGGTGAGGGGAGGACGGATAGG - Intronic
915567409 1:156723312-156723334 CTGGTGATATGAGGAGGCAGAGG - Exonic
915742566 1:158130240-158130262 CTGGTGAGGGGTGGAGTCTGGGG + Intergenic
915896301 1:159813722-159813744 CTGGTGGTGGGAGAAGGGGGTGG + Intronic
916047687 1:161013073-161013095 TAGAGGATGGGAGGAGGGTGAGG - Intronic
916382794 1:164231621-164231643 CTGGTAAGGGGAGGGTGGTGGGG + Intergenic
916654290 1:166859775-166859797 TTGGTGGTGGGAGGAGGAGGAGG - Intronic
916666744 1:166974291-166974313 CTGCTGAAGGGAGTAGGATGGGG - Intronic
916685167 1:167137663-167137685 CTGGTGTGGGGAGCAGGGAGGGG + Intergenic
916913053 1:169372602-169372624 CAAGGGATGGGAGGAGGATGAGG + Intronic
917218696 1:172704555-172704577 CTGGTGTTGGGGGAAGGGGGAGG + Intergenic
917508184 1:175648057-175648079 ATTCTGATGGGTGGAGGGTGTGG - Intronic
917536926 1:175881091-175881113 CTGGTGTGGGGATGATGGTGTGG + Intergenic
917750299 1:178047114-178047136 CTGGTGGAGGGCTGAGGGTGGGG + Intergenic
917887287 1:179398864-179398886 CAGGGGTTGGGGGGAGGGTGTGG + Intronic
917925261 1:179784201-179784223 CTGGTGAAGGCAGGAGGTTCTGG - Intronic
918131061 1:181630112-181630134 ATGGGAATGGGGGGAGGGTGGGG + Intronic
918236969 1:182590248-182590270 TTGGTGTTGGGATGAGGATGAGG - Intergenic
918417165 1:184322460-184322482 CTGGGGATGGGGGGAGGTGGCGG - Intergenic
918449124 1:184642017-184642039 CTGCTTATGGGAGGAGGGACTGG - Intergenic
919221640 1:194638268-194638290 CGGAGGGTGGGAGGAGGGTGAGG - Intergenic
919478642 1:198059165-198059187 CACTTGGTGGGAGGAGGGTGAGG - Intergenic
919834921 1:201567049-201567071 CTGGGGATGGGGGGTGGGAGGGG - Intergenic
920061495 1:203229756-203229778 GGGGGGATGGGAGCAGGGTGGGG + Intronic
920150842 1:203906090-203906112 CTGGGGAGGGGAGTAGGGAGAGG + Intergenic
920557543 1:206915000-206915022 GTGGTGCTGGGAGCATGGTGCGG + Intronic
920850523 1:209625222-209625244 CTGCTGGTGGGATGGGGGTGTGG + Intronic
920950166 1:210565057-210565079 CTGGAGATGGGAGGTGGGAAGGG + Intronic
921409756 1:214823260-214823282 GAGGTGGTGGGAGGGGGGTGGGG + Intergenic
921503412 1:215935506-215935528 GTGGTGTTGGGACCAGGGTGAGG - Intronic
921583017 1:216916741-216916763 TTGCTCATGAGAGGAGGGTGAGG - Intronic
921948306 1:220904241-220904263 CAGGTGGTGGGAGGTGGCTGAGG - Intergenic
922380836 1:225023082-225023104 CTGCTTGAGGGAGGAGGGTGAGG + Intronic
922467232 1:225852764-225852786 CTGGTTCTGGGAGGAGGAGGTGG + Exonic
922654582 1:227370560-227370582 GTGGTGGAGGGTGGAGGGTGGGG - Intergenic
922914141 1:229241651-229241673 CTTGAGATGGGATGTGGGTGGGG - Intergenic
922915206 1:229251868-229251890 GTGGTGGTGGGAGGAGGAGGAGG - Intergenic
923018057 1:230142155-230142177 GTGGAGGTGGGGGGAGGGTGGGG + Intronic
923021509 1:230167694-230167716 GTGGTGATGGGAGGAAGGGGCGG + Intronic
923070211 1:230557353-230557375 CTGGGGATGGGAGGGAGGTCAGG + Intergenic
923388588 1:233490736-233490758 CTGCTCCTGGGAAGAGGGTGTGG - Intergenic
923485151 1:234422597-234422619 GTGGTGGTAGGGGGAGGGTGTGG + Intronic
924106303 1:240652779-240652801 CTGGTGATCGGAGTAGGGACAGG + Intergenic
924282060 1:242448333-242448355 CTGGTGATGAAGGGAGGGTTGGG - Intronic
924473900 1:244367071-244367093 CAGGGGGTGGGAGAAGGGTGCGG + Intronic
924604029 1:245516869-245516891 CTGGTGATTGGCGGAGTTTGGGG + Intronic
924630997 1:245740715-245740737 AGGGTGGTGGGAGGAGGGAGAGG + Intergenic
924741008 1:246794156-246794178 CAGGGGAAGGCAGGAGGGTGGGG + Intergenic
1063079540 10:2752481-2752503 CAGGTGGTGGGAGGTAGGTGGGG - Intergenic
1063401628 10:5751998-5752020 CTGGGGTTGGGAGGAGGATGGGG - Intronic
1063517597 10:6712189-6712211 GCGGGGAGGGGAGGAGGGTGCGG + Intergenic
1063892035 10:10640459-10640481 CTGGTGGTGGGAGGAGGGGAAGG - Intergenic
1064167218 10:12996926-12996948 GTGAGGGTGGGAGGAGGGTGAGG + Intronic
1064748634 10:18502811-18502833 TGGAGGATGGGAGGAGGGTGAGG + Intronic
1064818950 10:19301716-19301738 GTGGAGGTGGGAGGAGGGCGAGG + Intronic
1064869308 10:19920245-19920267 CTGCTGAGCAGAGGAGGGTGTGG + Intronic
1064876688 10:20002770-20002792 CTGTTTATGGGAAGAGGGAGGGG + Intronic
1065193462 10:23237028-23237050 GTGGAGGTGGGAGGAGAGTGAGG - Intronic
1065372568 10:25003813-25003835 CTGGGGGTGGAAGGAGGGAGAGG - Intronic
1065785159 10:29206099-29206121 GTGGTGATGGTATGAGGGAGTGG - Intergenic
1065937265 10:30531806-30531828 CTGGTGATGGGAGGCAGTAGAGG + Intergenic
1066003383 10:31125299-31125321 TTGGGGATGGGAGGAAAGTGGGG + Intergenic
1066021192 10:31304167-31304189 ATGGGGAGGGGAGGAGAGTGGGG + Intergenic
1066034558 10:31468257-31468279 TTGGTGATGGGTGGGGGGTGTGG - Intronic
1066250257 10:33626184-33626206 CAGGTGATGGGAGGGTGGGGAGG + Intergenic
1066317021 10:34258273-34258295 CTGGAGATGGGAGAGGGGTCAGG + Intronic
1067023954 10:42827435-42827457 CTGAGGATGGAAGAAGGGTGTGG + Intronic
1067077141 10:43194447-43194469 CTGGGGCAGGGAGGAGGGTGAGG - Intergenic
1067336986 10:45374189-45374211 CCAGTGGTGGGAGGAGGCTGCGG + Intronic
1067428429 10:46226497-46226519 CTGGTGGTGGGTGTGGGGTGGGG + Intergenic
1067582384 10:47453878-47453900 CAGGTGATGGGAAGATGGTGTGG - Intergenic
1067758507 10:49025491-49025513 CTGGGGATGGGAGGTGTGTGTGG - Intronic
1068397678 10:56485479-56485501 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1069273411 10:66559542-66559564 CTGCTAATTGGAGGTGGGTGTGG - Intronic
1069374579 10:67781059-67781081 CTGGTGCTGGGAGTAAGGAGGGG + Intergenic
1069571829 10:69498849-69498871 CAGGTGAGGGCAGGAGGGAGAGG + Intronic
1069609878 10:69766029-69766051 CTGCTGATGGGAGGTAGGGGTGG + Intergenic
1069631951 10:69902613-69902635 GTGGTGATGGGGGGAGGAAGCGG - Intronic
1069719701 10:70541566-70541588 CTTGGGATGGGAGGAGGAGGAGG + Intronic
1069808043 10:71138181-71138203 CTGGAGATCTGAGCAGGGTGAGG - Intergenic
1069840144 10:71334749-71334771 ATGGGGATGGGGGGAGGCTGGGG - Intronic
1069872977 10:71544438-71544460 CTGGCGATGGGAGTAGGCTGGGG + Intronic
1070507459 10:77126721-77126743 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1070541503 10:77418570-77418592 CTGGAGATGGGGACAGGGTGTGG - Intronic
1070870611 10:79748430-79748452 CTGGTGATGAGTGGGGGTTGGGG - Intergenic
1071306440 10:84303063-84303085 CTGGTTCTGGGAGGAAAGTGAGG - Intergenic
1071637530 10:87270642-87270664 CTGGTGATGAGTGGGGGTTGGGG - Intergenic
1071657715 10:87467309-87467331 CTGGTGATGAGTGGGGGTTGGGG + Intergenic
1071820222 10:89272234-89272256 CAGGGGGTGGGAGGAGGGAGAGG - Intronic
1072520600 10:96226959-96226981 CTAGGCATGGGAGGAAGGTGAGG + Intronic
1072849526 10:98873354-98873376 CTGTTGCAGGGTGGAGGGTGAGG - Intronic
1073142059 10:101254634-101254656 CTGGTGATGGAAGTGGGGAGAGG + Intergenic
1073290703 10:102411953-102411975 GGGGTGATGGGTGGAGGGTCAGG - Intronic
1073391759 10:103183679-103183701 GTGGGGGTGGGAGGAGGGTGAGG + Intronic
1073860425 10:107732275-107732297 GTTGTGGTGGGAGGAAGGTGCGG + Intergenic
1074086095 10:110209924-110209946 CTGGTGAGGGGGGGTGGCTGGGG - Intronic
1074088559 10:110226705-110226727 CTTGTGATGGGAGGGGCATGTGG + Intronic
1074357583 10:112799677-112799699 CTTAGGCTGGGAGGAGGGTGGGG - Intronic
1074411181 10:113230163-113230185 CTGGACTTGGGAGGAGGCTGTGG + Intergenic
1074504868 10:114060588-114060610 CAGGGGCTGGGAGGAGGGGGAGG + Intergenic
1074580199 10:114711834-114711856 CTGAGGGTGGGAGGAGAGTGTGG - Intergenic
1074644453 10:115430642-115430664 TTGTGGATTGGAGGAGGGTGAGG - Intronic
1074813495 10:117127160-117127182 ATGGTGATGCGATGATGGTGGGG - Intergenic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1075335531 10:121606527-121606549 GTCGTGATGTGTGGAGGGTGGGG - Intergenic
1075358175 10:121802689-121802711 CTGGGGATGGGAGCAGTGGGTGG - Intronic
1075449277 10:122537615-122537637 CACTTGATGGGAGGAGGGTGAGG + Intergenic
1075595143 10:123723879-123723901 CTGGTTATGGGGGGATGGAGAGG - Intronic
1075776889 10:124994993-124995015 GTGGTGATGGGAGGGGCATGTGG - Intronic
1075886179 10:125901280-125901302 CTGGTGGATGGAGAAGGGTGGGG - Intronic
1075922702 10:126226182-126226204 GTGGTGGTGGGGGGAGGGGGCGG + Intronic
1075943981 10:126416611-126416633 CTGGGGGTGGGAGGAGGAAGAGG + Intergenic
1076059254 10:127400772-127400794 CTGGGGGTGGGAGGTGGGTGAGG - Intronic
1076151639 10:128167200-128167222 CAGGTGAGGGGGCGAGGGTGAGG - Intergenic
1076311414 10:129510375-129510397 CTGGTGGTGGGAGCACGTTGAGG + Intronic
1076325454 10:129617117-129617139 TTGAGGGTGGGAGGAGGGTGAGG - Intronic
1076697842 10:132255719-132255741 CAGGAGAGGGGATGAGGGTGTGG + Intronic
1076889929 10:133278462-133278484 GTGGTGATAGGAGGAGGGGAGGG - Intergenic
1076979384 11:196578-196600 CTGGTGAGGGGAACATGGTGAGG + Intronic
1077020373 11:414522-414544 GTGGTAATGGGAGGTGTGTGTGG - Intronic
1077081371 11:726040-726062 CAGGTGCTGGGAGGCGGGGGCGG + Intronic
1077289056 11:1780454-1780476 GTGGTGATCGGGGGAGGGTGAGG + Intergenic
1077356552 11:2121515-2121537 CTGGTGGTGTGAGCGGGGTGAGG - Intergenic
1077481924 11:2818972-2818994 CTGGAGCTGGGAGCAGGATGTGG - Intronic
1077543320 11:3157853-3157875 TTGGTGCAGGGACGAGGGTGGGG + Intronic
1077553737 11:3215964-3215986 CTGGAAATGGGATAAGGGTGGGG - Intergenic
1077746521 11:4913244-4913266 CTGGTGTTGGGAGCAGGGACAGG + Intronic
1077798933 11:5518861-5518883 CTGGTGATGAGAAGGGGCTGTGG - Intronic
1077851238 11:6075921-6075943 GTGGTGTTGGGAGGAGGATGGGG + Intergenic
1078062227 11:8055629-8055651 CTGCTGATGGGCTGGGGGTGGGG + Intronic
1078268108 11:9770077-9770099 CTGGGGGTGAGAGGAGGGGGAGG - Intergenic
1078272682 11:9811192-9811214 TTGGAGGTGAGAGGAGGGTGAGG + Intronic
1078290382 11:10004999-10005021 CTGGTGGTGGCATGGGGGTGGGG - Intronic
1078442827 11:11381472-11381494 GTATTGATGGGAGGAGGCTGAGG + Intronic
1078518730 11:12046968-12046990 CTGCTGAGGTGAGGAGGCTGAGG - Intergenic
1078662988 11:13302109-13302131 GTGGGGATGGGAGGAGGGTTTGG + Intronic
1079001196 11:16758255-16758277 CTGGTGAGGGTAGGAGGGCTTGG - Intergenic
1079104938 11:17564565-17564587 CTGGTGAAGCGGGGAGTGTGTGG + Intronic
1079946205 11:26744862-26744884 CTGGTCATGGGAGGAAGATATGG - Intergenic
1080003546 11:27379445-27379467 CAGGTAATGTGAGGAGGGTAAGG - Intronic
1080250529 11:30228451-30228473 ATGGTGATGGCTGGAAGGTGTGG - Intergenic
1080573369 11:33577078-33577100 AGGGAGATGGGAGGAGAGTGTGG + Intronic
1080758306 11:35223571-35223593 CTGGTCTTGGGAGGAGGGAGAGG - Intronic
1080824535 11:35836866-35836888 CTGGTCATGGAGGCAGGGTGAGG + Intergenic
1080979649 11:37385892-37385914 CTGGTGGTGGGGGGCGGGGGGGG + Intergenic
1081691237 11:45080105-45080127 GTGCTGGTGGGGGGAGGGTGAGG - Intergenic
1081938315 11:46919378-46919400 CTGGGGCTGGAAGGAGGCTGAGG - Intergenic
1082028148 11:47587402-47587424 ATAGGGAGGGGAGGAGGGTGGGG + Intronic
1082795552 11:57376154-57376176 GTGGGGATGGGAGTAGGGTTGGG - Intergenic
1083114754 11:60449773-60449795 TGGAGGATGGGAGGAGGGTGAGG + Intronic
1083144492 11:60748548-60748570 CTGCTCATCAGAGGAGGGTGCGG + Intergenic
1083224121 11:61273924-61273946 CTGGCGAGGGAAGAAGGGTGGGG - Intronic
1083327355 11:61879576-61879598 CTGGCGATGGGAGGAGCGGCTGG - Intronic
1083616988 11:64031174-64031196 CTGGTGCTGGGAGCAGGGAGGGG - Intronic
1083743631 11:64723508-64723530 CTGGCCGTGGGGGGAGGGTGCGG - Intergenic
1083752218 11:64766935-64766957 CTGCTGCTGGGCGGAGGGGGTGG + Exonic
1083991139 11:66246458-66246480 CCGAGGATGGGAGCAGGGTGGGG - Intergenic
1084062782 11:66686950-66686972 CTCGGGATGGGAGGAGAGTTGGG - Intronic
1084369128 11:68726939-68726961 CTTGTGATAGCAGGAGGTTGAGG + Intronic
1084539119 11:69775486-69775508 CGGGGGAAGGGAGGAGGCTGGGG + Intergenic
1084596160 11:70118203-70118225 CTGGAGAATGGAGGAGGGGGAGG - Intronic
1084692622 11:70735886-70735908 ATGGTGATGGGTGTAGGGTTTGG - Intronic
1084698900 11:70773043-70773065 CTGGGGATGGGCGGAGACTGGGG - Intronic
1084779238 11:71397722-71397744 CTGGAGAAGAGAGGAAGGTGTGG - Intergenic
1084904351 11:72334602-72334624 CTGGAGAGGGCAGGCGGGTGAGG - Intronic
1084984450 11:72855491-72855513 CTGGAGATGGATGGATGGTGGGG + Intronic
1085014718 11:73166212-73166234 CTGGTGAGGAGAGGAGCCTGGGG + Intergenic
1085482931 11:76837733-76837755 CAGATGATGGGAGCAGGGAGTGG - Intergenic
1086247399 11:84770447-84770469 CGGAGGATGGGAGGAGGGAGAGG - Intronic
1086461434 11:87009475-87009497 CTATTGATGGGAGAGGGGTGCGG + Intergenic
1086824601 11:91480558-91480580 AGGGTGAAGGGTGGAGGGTGAGG + Intergenic
1086872620 11:92056929-92056951 CTTCTGGTGGGGGGAGGGTGCGG - Intergenic
1087064156 11:94011705-94011727 CAGGGGCTGGGTGGAGGGTGTGG + Intergenic
1087112745 11:94488795-94488817 CAGATGATAGGAGGAGGGAGAGG + Intronic
1087502997 11:98983444-98983466 CTGTTGATGGGTGGGGCGTGGGG - Intergenic
1087522466 11:99258289-99258311 TTGAAGGTGGGAGGAGGGTGAGG - Intronic
1087607195 11:100391077-100391099 TTGGGGGTGGGAGGAGGGAGAGG + Intergenic
1088754623 11:112875671-112875693 CGAGTGAGGGAAGGAGGGTGGGG + Intergenic
1088838135 11:113596836-113596858 CTGGAGATGGGGTGGGGGTGGGG + Intergenic
1088912354 11:114201233-114201255 GTGGAGGTGGGAGGAGGGGGAGG + Intronic
1088918208 11:114242942-114242964 CAGGTGATGGGACAAGGGAGGGG + Intronic
1089297568 11:117479291-117479313 CTGGTGAGGGAAGGAGACTGAGG + Intronic
1089388254 11:118081989-118082011 GTGGAGATGGGATGAAGGTGAGG - Intronic
1089640719 11:119845540-119845562 CTGGTGAAGGCAGGGTGGTGCGG + Intergenic
1090253628 11:125267931-125267953 CAAGTGATGGGAGGATGGTAGGG + Intronic
1090381138 11:126328497-126328519 CTGCTGAGGGGAGGCGGGAGGGG + Intronic
1090570026 11:128035779-128035801 GTGGTGGTGGCAGGCGGGTGGGG - Intergenic
1090663049 11:128895378-128895400 CTGGGGTTGGGGGGGGGGTGGGG - Intronic
1091002692 11:131923837-131923859 CTGGGGATGGGAGGAGGGTCGGG - Intronic
1091015843 11:132050149-132050171 CTGGGGAAGGGAGAAGGGTGAGG + Intronic
1091251161 11:134145455-134145477 GTGGTGGTGGGAGGTGGGGGAGG + Intronic
1091277598 11:134362838-134362860 CTGGGGCTGGGAGTGGGGTGAGG + Intronic
1091278757 11:134370210-134370232 CTGTGGATGGGAGCCGGGTGGGG + Intronic
1091304723 11:134530201-134530223 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304737 11:134530231-134530253 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304744 11:134530248-134530270 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304751 11:134530265-134530287 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304758 11:134530282-134530304 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304765 11:134530299-134530321 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304772 11:134530316-134530338 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304779 11:134530333-134530355 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304806 11:134530393-134530415 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304820 11:134530423-134530445 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304834 11:134530453-134530475 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304848 11:134530483-134530505 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304855 11:134530500-134530522 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091304869 11:134530530-134530552 GTGGGGAACGGAGGAGGGTGGGG - Intergenic
1091455926 12:607812-607834 ATGGGGATGAGAGGAGGCTGGGG + Intronic
1091608345 12:1978670-1978692 CTGGTGGTGGAAGTGGGGTGTGG - Intronic
1091768989 12:3139361-3139383 AGGGTGAGGGGAGGAGGGGGAGG - Intronic
1092245876 12:6863979-6864001 CTGGGGTGGGGAGCAGGGTGGGG + Intronic
1092253488 12:6914407-6914429 GTGGGGAAGGGAGGAGGATGGGG - Intronic
1092342097 12:7685549-7685571 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1092441100 12:8505159-8505181 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1093030333 12:14282648-14282670 CGGAGGGTGGGAGGAGGGTGAGG + Intergenic
1093541568 12:20293383-20293405 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1093659233 12:21735411-21735433 TGGGAGATGGGAGGAGGGAGAGG + Intronic
1094141123 12:27182898-27182920 CAAGTGCTGGGAGGAGGGTGGGG + Intergenic
1094386503 12:29900226-29900248 TTGGGGGTGGGAAGAGGGTGAGG - Intergenic
1094391848 12:29960293-29960315 TTGGTGATGAGAGGAGGTGGTGG - Intergenic
1094816102 12:34186403-34186425 CTGCTGCTGGGTGGGGGGTGGGG + Intergenic
1095101000 12:38183867-38183889 CTGCTGCTGGGTGGGGGGTGGGG - Intergenic
1095517419 12:43021654-43021676 CTGGTAAAAGGAGGTGGGTGTGG + Intergenic
1095520193 12:43054728-43054750 CTAGGGGTGGGAGGAGGGTGTGG - Intergenic
1095570254 12:43675876-43675898 CTGGCGATGGGTGGGGTGTGTGG - Intergenic
1095825309 12:46524806-46524828 ATGGAGATGGGAGGAGGCTAGGG + Intergenic
1095943584 12:47741130-47741152 CTCGTGTTAGGAGGAGGGTTAGG + Intronic
1095967568 12:47879209-47879231 CTGGTGGTGGGGGGTGGGGGCGG - Intronic
1096155961 12:49341772-49341794 CAGGTGAAAGGAGGCGGGTGGGG + Intergenic
1096413077 12:51391234-51391256 TGGGTGAGGGGAAGAGGGTGTGG + Intronic
1096459146 12:51812569-51812591 CTGGTGATGAGAAGCGGGGGTGG - Exonic
1096653132 12:53071941-53071963 AAGGTGTTGGGGGGAGGGTGGGG + Intronic
1096682409 12:53265203-53265225 CTGAGGCTGGGAGGAGGCTGAGG - Intergenic
1096779637 12:53984624-53984646 TTGGGGATGGGAGTGGGGTGAGG - Intergenic
1096792490 12:54053700-54053722 GTGGTGCTGGGAGGCGGGGGTGG - Intronic
1096792693 12:54054773-54054795 CTGAGGATGGGGTGAGGGTGGGG + Intronic
1096848111 12:54418944-54418966 CTGGAGACGGGATGGGGGTGGGG - Intronic
1096877745 12:54643884-54643906 CTGGGGATGGGAGGTTGGTGGGG + Intergenic
1097135224 12:56847490-56847512 TGGGTGGTGGGAGGAGGGAGAGG - Intergenic
1097251102 12:57632715-57632737 TTGGTGAGGGGAGGAGGAGGAGG - Intronic
1097265177 12:57740201-57740223 CTGGTGGGGGGCTGAGGGTGGGG + Intronic
1097573124 12:61357010-61357032 CTGCTGCTGCGAGGAGGGTGTGG - Intergenic
1097651491 12:62303596-62303618 CGGGGGATGGGGGGAGGGTCGGG - Intronic
1097740057 12:63231347-63231369 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
1098706151 12:73692356-73692378 ATGGGGATGGGAGGAGGAAGAGG + Intergenic
1098919355 12:76289387-76289409 CTGGTGAGGAGAGGAGAGGGAGG - Intergenic
1099860059 12:88215028-88215050 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
1099860230 12:88217394-88217416 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1099901624 12:88717728-88717750 CTAGGGCTGGGAGGAGGGAGAGG + Intergenic
1099951366 12:89308112-89308134 CTGGTCAAAGGAGGAGAGTGAGG + Intergenic
1100772794 12:97941854-97941876 CAGATGGTGGGAGGAGGGTGAGG + Intergenic
1101690721 12:107077818-107077840 CAGGTGAGGGGAGGGGAGTGGGG - Intronic
1101725607 12:107385849-107385871 GTGAGGATGGCAGGAGGGTGGGG - Intronic
1102637492 12:114336890-114336912 CTGGGGAGTGGTGGAGGGTGAGG - Intergenic
1102777297 12:115531680-115531702 GTGGGGATGGGGTGAGGGTGAGG - Intergenic
1103039832 12:117685764-117685786 CTGGTGGTGGGTTGGGGGTGGGG - Intronic
1103383596 12:120514263-120514285 CTGGGGGTGGGAGGAGGAAGAGG + Intronic
1103704110 12:122862194-122862216 CGGCTGATGGGACGAGGGTCAGG + Exonic
1103920199 12:124395336-124395358 CAGGCGATGGCAGGAGGGAGCGG - Intronic
1103978340 12:124718976-124718998 GTGGGGGTGGGAGGAGGATGAGG + Intergenic
1104114256 12:125734277-125734299 CTGGTGGTGGGAGGGGCGTCAGG + Intergenic
1104751941 12:131245462-131245484 CTGGCAATGGGAGGAGGCTCTGG - Intergenic
1104965301 12:132506225-132506247 CTGTGGATGGGAGGAGGGGCCGG + Intronic
1104998487 12:132673944-132673966 CTGAGGATGGGAGGAAGGCGAGG - Intronic
1105520895 13:21130044-21130066 CTGAGGATGGGACAAGGGTGTGG + Intergenic
1105533634 13:21243517-21243539 GCAGAGATGGGAGGAGGGTGAGG + Intergenic
1105700727 13:22934486-22934508 CTGGTCATTGAAGGATGGTGGGG - Intergenic
1105974687 13:25463050-25463072 CTGGCGTTGGGAGGATGATGAGG + Intronic
1106241291 13:27915757-27915779 ATGGTGGTGGGAGGAGGAGGTGG + Intergenic
1106246271 13:27953458-27953480 GTGGGGCAGGGAGGAGGGTGGGG - Intergenic
1107291999 13:38865274-38865296 CTGATGATGGGGTGGGGGTGAGG - Intronic
1107569306 13:41639771-41639793 TCGGCGGTGGGAGGAGGGTGAGG + Intronic
1107836588 13:44416571-44416593 CTGGAGATGAGGGGAGGGAGGGG - Intergenic
1108029516 13:46214759-46214781 CTGTTAGTGGGTGGAGGGTGAGG - Intronic
1108224069 13:48269658-48269680 CATGTGAGGGAAGGAGGGTGTGG - Exonic
1108323355 13:49307115-49307137 CTGGGGATGGGGGGCGGGTATGG - Intergenic
1108501297 13:51072185-51072207 CTGGGGATGGGGGTGGGGTGGGG - Intergenic
1108529321 13:51314300-51314322 GTGGAGCTGGGAGGAGGGTGAGG + Intergenic
1108741000 13:53338343-53338365 CTGGTGGTGAGGAGAGGGTGTGG + Intergenic
1108807803 13:54181404-54181426 CAGAGGGTGGGAGGAGGGTGAGG - Intergenic
1109589618 13:64460932-64460954 CGGAGGGTGGGAGGAGGGTGAGG - Intergenic
1110273020 13:73612713-73612735 CTTTTGATGGGTAGAGGGTGGGG - Intergenic
1110314353 13:74088024-74088046 CGAGTGATTGGAGGAGGGAGTGG + Intronic
1110407124 13:75162979-75163001 GTGGTGATGGGAGCAGGGGTGGG + Intergenic
1110482092 13:75990553-75990575 CAGAGGGTGGGAGGAGGGTGAGG + Intergenic
1110606320 13:77437109-77437131 CTGGGGATTGTCGGAGGGTGGGG + Intergenic
1110992061 13:82054589-82054611 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
1111068307 13:83127835-83127857 CTACTGATGGGATGATGGTGGGG - Intergenic
1111192948 13:84833057-84833079 CCGGGGATGGGAGGGGGATGAGG - Intergenic
1111532799 13:89561490-89561512 GTGGAGGTGGGAGGAGGGAGAGG + Intergenic
1111655396 13:91145634-91145656 TTGGTGAGGGGAGGTGTGTGTGG + Intergenic
1111828472 13:93297660-93297682 GAGGTGAAGGGGGGAGGGTGGGG - Intronic
1112174548 13:97009055-97009077 GAGAGGATGGGAGGAGGGTGAGG + Intergenic
1112454678 13:99548194-99548216 GTGCAGATGGGAGCAGGGTGTGG - Intronic
1112505793 13:99974955-99974977 CTGGGGTTGGAAGGAGGTTGGGG - Intergenic
1112938937 13:104837489-104837511 CTTGTGATGGGTGGATGGGGAGG - Intergenic
1113095965 13:106664001-106664023 CTGGGCATGGGAGGTGGGGGTGG - Intergenic
1113126979 13:106990189-106990211 CTGGTGCTGGGCTGGGGGTGAGG + Intergenic
1113185446 13:107681764-107681786 CTGGTGACAGGAGGAAGGAGGGG - Intronic
1113222705 13:108123260-108123282 GAGGAGATGGTAGGAGGGTGAGG + Intergenic
1113362985 13:109648682-109648704 TTGGGGGTGGGAGGAGGGAGAGG - Intergenic
1113452390 13:110420403-110420425 CTGGTGGTGGGAGCAGGGCGGGG + Intronic
1113458527 13:110465766-110465788 CTGCTGAGGGGAGGCTGGTGGGG - Intronic
1113750982 13:112776284-112776306 CCGGGGATGGAAGGAGGGTCTGG - Intronic
1113857062 13:113452853-113452875 GTGCTGGTGGGAGTAGGGTGAGG - Intronic
1113923644 13:113928558-113928580 CTGGTGATGCAGCGAGGGTGGGG - Intergenic
1114552124 14:23538749-23538771 CTGGTGTAGGGTGGAGGTTGGGG + Intronic
1114594840 14:23902824-23902846 CGGAGGATGGGAAGAGGGTGAGG - Intergenic
1115733633 14:36299503-36299525 TTGAAGATGGGAGGAGGGAGAGG + Intronic
1115848180 14:37561109-37561131 TTGGTGGTGGGGTGAGGGTGGGG - Intergenic
1115918297 14:38342390-38342412 CTGGAGTTGGGAGAAGGGTGAGG - Intergenic
1116135784 14:40921765-40921787 CCGGGGATGGGAGGAGAGGGAGG - Intergenic
1116536327 14:46035755-46035777 CTAGAGATGGGAGGTTGGTGTGG + Intergenic
1117026351 14:51624151-51624173 CAGGGGATGGGAGGAGGGAGAGG + Intronic
1117340618 14:54788477-54788499 CTGGTGCTGGCAGGAGGAGGAGG - Intronic
1117474591 14:56081088-56081110 CTGGAGGAGGGAGGAGAGTGAGG - Intergenic
1118098010 14:62561152-62561174 CTGTTGTTGGGTGGAGGGAGGGG + Intergenic
1118163143 14:63310973-63310995 CAGGGGATGGGAGGAGAGTGAGG + Intergenic
1118289089 14:64504125-64504147 CTGGGGAAGGGATGAGGGCGCGG + Intronic
1118723267 14:68609040-68609062 CAGGTGAAGGGAGGAAGCTGCGG - Intronic
1119004435 14:70910215-70910237 CTGGTGAGAGGAGGAGGAGGAGG - Intronic
1119054906 14:71409263-71409285 TTGATGATGGGATGTGGGTGTGG + Intronic
1119217821 14:72882761-72882783 CTGGTGATAGGGGGAGGGCAGGG - Intronic
1119414022 14:74457463-74457485 CAGAGGATGGAAGGAGGGTGCGG - Intergenic
1119800253 14:77437996-77438018 ATGGTTATTGGAGGCGGGTGGGG + Intronic
1119995814 14:79252576-79252598 GTGGTGGTGGGAGGTGGGTAGGG + Intronic
1120147550 14:80995681-80995703 TGGGGGATGGGAGGAGGGAGAGG + Intronic
1120323320 14:82993603-82993625 TGGGAGGTGGGAGGAGGGTGAGG - Intergenic
1120538078 14:85721833-85721855 CTGGTGGTGGGAGGGGGCGGAGG - Intergenic
1120686330 14:87542305-87542327 CATGTGAAGGGAGGGGGGTGAGG - Intergenic
1121426326 14:93854724-93854746 CTGCTGTTTGGAGCAGGGTGTGG + Intergenic
1121765012 14:96478737-96478759 GTGGGGCTGGGGGGAGGGTGGGG + Intronic
1121840423 14:97129486-97129508 CTGGTGATGAGATTTGGGTGGGG + Intergenic
1121886798 14:97550528-97550550 CTGGAGCTTGGAGGAGGCTGGGG + Intergenic
1122030259 14:98906896-98906918 TTGGAGTTTGGAGGAGGGTGTGG - Intergenic
1122117393 14:99534760-99534782 CTGGTGAGGGCAGGAGGGGCTGG - Intronic
1122326679 14:100884875-100884897 CTGGTGGTGGAAGGGGAGTGTGG + Intergenic
1122403025 14:101478683-101478705 CTGGAGGTGGGGGGTGGGTGTGG - Intergenic
1202855974 14_GL000225v1_random:52552-52574 GTGGTGTGGGGAGGAGGGCGTGG - Intergenic
1124036102 15:26054683-26054705 TGGGTGATGGGGGCAGGGTGAGG + Intergenic
1124911228 15:33922677-33922699 CTTGTGATTAGAGGAGGCTGAGG - Intronic
1125109633 15:36015618-36015640 CTGGAGATGGAAAGAAGGTGTGG + Intergenic
1125119514 15:36137852-36137874 TTGGGGGTGGGAGGAGGGAGAGG - Intergenic
1125191801 15:37002254-37002276 CAGGTGATGGGGTGGGGGTGGGG - Intronic
1125400902 15:39301669-39301691 CAGGGGATGGGAGGAGGGAAGGG + Intergenic
1125460033 15:39897487-39897509 ATGGTGAAAGGTGGAGGGTGAGG - Intronic
1125541220 15:40471123-40471145 CTGGGGGCGGGAGGAGGGTCTGG - Exonic
1126139319 15:45424485-45424507 CTGGTAACTGGAGGTGGGTGGGG + Intergenic
1126179699 15:45773103-45773125 CAGGAGATGGGAGGAGAGGGAGG + Intergenic
1126195944 15:45932063-45932085 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1127725341 15:61744089-61744111 CTGGGGAGGAGAGGAGGGAGCGG + Intergenic
1127746301 15:61979079-61979101 ATGGTGAAGGGTGTAGGGTGGGG - Intronic
1127981070 15:64035549-64035571 CTGGTGATAGAACCAGGGTGGGG - Intronic
1128065527 15:64762200-64762222 GTGGCGATGGCAGGGGGGTGGGG + Intronic
1128306385 15:66601479-66601501 CTGCTGATGGGGTGGGGGTGGGG + Intronic
1128595033 15:68937612-68937634 CTGTTGGTGGGTGGGGGGTGAGG - Intronic
1128682454 15:69661839-69661861 CTGATGATAGGATGAGGGTGGGG + Intergenic
1129250996 15:74308950-74308972 CAGGAGAAGGCAGGAGGGTGAGG - Intronic
1129261222 15:74368493-74368515 AGGGTGATGGGGGGTGGGTGTGG - Intergenic
1129488863 15:75904101-75904123 CTGGTGAGGAGAGGAGGCGGAGG + Exonic
1130892742 15:88147274-88147296 CTGGTAATGGGTGGATGGGGAGG - Intronic
1131030644 15:89183724-89183746 GTAGGGAAGGGAGGAGGGTGTGG - Intronic
1131032066 15:89194860-89194882 CTGGGGGTGGGAGGTGGGAGAGG - Intronic
1131175962 15:90210004-90210026 CTGGAGATGGGAGGCTGGTTGGG + Intronic
1131279585 15:91009704-91009726 CTGGTGGTGGGGGTGGGGTGGGG + Intronic
1131434630 15:92413027-92413049 CTGGTGGGGGGTGTAGGGTGGGG + Intronic
1131950304 15:97674120-97674142 CTGGGGATGCAAGAAGGGTGGGG + Intergenic
1132270242 15:100517776-100517798 CTAGTTCTTGGAGGAGGGTGGGG + Intronic
1132325035 15:100961746-100961768 CTGTTGTTGGGAGCTGGGTGGGG + Intronic
1132581277 16:685826-685848 GTGCTGATGGGAGAGGGGTGGGG - Intronic
1132656119 16:1042678-1042700 CTGGAGCTGGGAGGGAGGTGGGG + Intergenic
1132688910 16:1173686-1173708 GGGGTGAGGGAAGGAGGGTGGGG + Intronic
1132898026 16:2238111-2238133 CTGGTGCAGGGAGGAAGCTGAGG - Intronic
1132941618 16:2511378-2511400 CTGGTGATGAGAAGCGGGAGGGG + Intronic
1133873329 16:9710104-9710126 CGGAAGATGGGAGGAGGGAGAGG - Intergenic
1134058001 16:11182314-11182336 CTGGTGCGGGGAGGAGGGAGAGG - Intergenic
1134073005 16:11272278-11272300 CTGGTGCTTGGAGGACTGTGAGG + Intronic
1134254283 16:12598861-12598883 CTGATTGTGGGAGGATGGTGAGG - Intergenic
1134254959 16:12603093-12603115 CTGTTTATGGGAGGAGGTGGTGG - Intergenic
1134493244 16:14711921-14711943 CTGGCCTTGGGAGGAGCGTGGGG + Intronic
1134498625 16:14751045-14751067 CTGGCCTTGGGAGGAGCGTGGGG + Intronic
1134525179 16:14937675-14937697 CTGGCCTTGGGAGGAGCGTGGGG + Intronic
1134547715 16:15123244-15123266 CTGGTCTTGGGAGGAGCGTGGGG - Intronic
1134564864 16:15242720-15242742 TAGAGGATGGGAGGAGGGTGAGG + Intergenic
1134581949 16:15378040-15378062 CTGGCCTTGGGAGGAGCGTGGGG - Intronic
1134712767 16:16336162-16336184 CTGGCCTTGGGAGGAGCGTGGGG + Intergenic
1134720631 16:16379477-16379499 CTGGCCTTGGGAGGAGCGTGGGG + Intronic
1134737632 16:16513978-16514000 TAGAGGATGGGAGGAGGGTGAGG - Intergenic
1134929873 16:18198182-18198204 TAGAGGATGGGAGGAGGGTGAGG + Intergenic
1134946796 16:18332408-18332430 CTGGCCTTGGGAGGAGCGTGGGG - Intronic
1134954060 16:18372531-18372553 CTGGCCTTGGGAGGAGCGTGGGG - Intergenic
1135249834 16:20891616-20891638 GTGGTGATGGGTGGTGGGTGTGG + Intronic
1135269119 16:21053770-21053792 TTGGTGATGGAGTGAGGGTGTGG + Intronic
1135592103 16:23712129-23712151 CTGGTGTTGAGTGGAGGGTCAGG + Intronic
1135784865 16:25339743-25339765 ATGGTGATGGAAGGAAGATGAGG + Intergenic
1136072345 16:27795330-27795352 CAGGTGATGGCAGGGGGCTGGGG + Intronic
1136287613 16:29253654-29253676 CTGCAGATGTGAGGAGGGTGAGG + Intergenic
1136317917 16:29465089-29465111 CTGGGGAGGGGAGAAGGGTTTGG + Exonic
1136381842 16:29899576-29899598 CTGGGGACGGGCGGAGGGAGGGG + Intergenic
1136413393 16:30090140-30090162 CAGGGGAGGAGAGGAGGGTGGGG - Intronic
1136432492 16:30204438-30204460 CTGGGGAGGGGAGAAGGGTTTGG + Exonic
1136859756 16:33691269-33691291 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1137361390 16:47819339-47819361 CTGGTAAAGGGAGGAGAGAGTGG - Intergenic
1137582492 16:49641841-49641863 CTGGAGATGGGAGCAGGGACTGG + Intronic
1137692765 16:50440997-50441019 CTGGTGCTGGGAGGAGCTTGGGG + Intergenic
1138202157 16:55097409-55097431 CTGTTGAGGGGTGGAGGTTGAGG - Intergenic
1138291894 16:55855022-55855044 CTGGTGATGGAAGGGGTGGGTGG - Intronic
1138339086 16:56276856-56276878 CTGGAGATTGGAGAAGGGGGCGG + Intronic
1138519108 16:57560673-57560695 TTGGGGATGGTAGGATGGTGAGG + Intronic
1138655454 16:58488647-58488669 CTGGTGATGGGAGGCTGGGGAGG - Intronic
1139087295 16:63602607-63602629 GTGGAGATGGGAATAGGGTGAGG + Intergenic
1139545479 16:67647785-67647807 GGGGTGAGGGGAGGGGGGTGGGG + Intronic
1140807915 16:78550697-78550719 CTGGGGATGGCAGCAGAGTGGGG + Intronic
1140915821 16:79492245-79492267 CTGGGGCTGGGATTAGGGTGAGG + Intergenic
1141179350 16:81742030-81742052 CTGGGAAGGGGAGGAGGGAGGGG - Intronic
1141194009 16:81846056-81846078 CTGGTAATGGGAGCTGAGTGGGG - Intronic
1141388567 16:83645651-83645673 CTGGTGATTGGAGAAGGATGGGG - Intronic
1141459113 16:84166726-84166748 CTGGTGCTGGCAGGTAGGTGAGG - Intronic
1141624234 16:85253065-85253087 CTGGTGGGGGGGGGGGGGTGGGG - Intergenic
1141790034 16:86228081-86228103 CTGGTGGCAGGAGGAGGGCGCGG - Intergenic
1142093236 16:88226282-88226304 CTGCAGATGTGAGGAGGGTGAGG + Intergenic
1142126031 16:88411193-88411215 CTGAGGTTGGGTGGAGGGTGGGG - Intergenic
1142155665 16:88531887-88531909 CTGGGGTGGGGAGGACGGTGGGG + Intronic
1142199434 16:88754088-88754110 CTGGTGAGGCGAGGGGGTTGGGG - Intronic
1142294526 16:89211639-89211661 CAGGGGAGGGGAGCAGGGTGAGG + Intergenic
1142343027 16:89536496-89536518 CAGGTGAGGTGAGGCGGGTGAGG + Intronic
1142343040 16:89536548-89536570 CAGGTGAGGTGAGGCGGGTGAGG + Intronic
1142343052 16:89536595-89536617 CAGGTGAGGTGAGGTGGGTGAGG + Intronic
1203121262 16_KI270728v1_random:1539448-1539470 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1142466898 17:141429-141451 TTGGTGAGGGGAGCATGGTGAGG + Intergenic
1142466961 17:141603-141625 CTGGTGAGGGGAACACGGTGAGG + Intergenic
1142743786 17:1945002-1945024 CTGGGGAGGGAAGGAGGGGGTGG - Intronic
1143097222 17:4484750-4484772 CAGGGGATGGAAGGAGGGAGGGG - Intronic
1143176389 17:4957606-4957628 CAGGAGAGGGGAGCAGGGTGGGG + Intergenic
1143639524 17:8188231-8188253 CTGGTGCTGGGAGTGGGGTGGGG - Intergenic
1143725201 17:8839739-8839761 ATGGAGGTGGGACGAGGGTGAGG - Intronic
1143863514 17:9908004-9908026 CTGGGGATGGAGGGAGAGTGAGG + Intergenic
1143907988 17:10225105-10225127 CTGGTGAGGAGAGGAAGCTGGGG + Intergenic
1144137769 17:12314687-12314709 CTGGTGGTGGTGGGAGTGTGGGG + Intergenic
1144198242 17:12916299-12916321 CTTGAGATGGGTGGAAGGTGGGG - Intronic
1145055997 17:19704346-19704368 CTGGGGCTGGGAGAAGGGTGGGG + Intronic
1145245774 17:21268477-21268499 CTAGGGATCGGAGGAAGGTGGGG - Intergenic
1145371673 17:22311476-22311498 CTGGTGGTGAGAGGAGTGGGTGG + Intergenic
1145772958 17:27506677-27506699 TTGGGGGTGGGAGGAGGGGGTGG - Intronic
1145792995 17:27639350-27639372 CTGGTGCTGGGGGGTGGGGGAGG - Intronic
1145807850 17:27747167-27747189 CTGGTGCTGGGAGGTAGGGGAGG - Intergenic
1145902112 17:28496061-28496083 CTGGGGTGGGGAGGTGGGTGAGG - Intronic
1146472862 17:33138614-33138636 CCGCTGATGGCAGGAAGGTGGGG - Intronic
1146625330 17:34431001-34431023 ATGGTGAGGGGTGGGGGGTGGGG - Intergenic
1146627994 17:34448524-34448546 GTGGTGGTGGAAGGAGGGTTAGG + Intergenic
1146820301 17:35979293-35979315 CTGGAGAGAGGAGGAGGGTCTGG + Intronic
1146970587 17:37068506-37068528 CTGGGGATGGAAGGAGGAGGAGG + Intergenic
1147036421 17:37684956-37684978 CAGGTGGTGGGAGGAAGGTGTGG + Intergenic
1147141257 17:38461717-38461739 CTGGGGAAGGGAGGAGGTGGGGG + Intronic
1147143844 17:38474244-38474266 CTGGGGATGGCAGGAGACTGGGG + Intronic
1147168304 17:38604817-38604839 CGGCTGAGGGGTGGAGGGTGGGG - Intronic
1147509765 17:41057919-41057941 CAGATGGTGGGAAGAGGGTGAGG + Intergenic
1147596990 17:41723925-41723947 TTGGTTAGGTGAGGAGGGTGAGG - Exonic
1147998707 17:44375517-44375539 GAGGGGATGGGAGGAGGGAGAGG - Intronic
1148166925 17:45490398-45490420 CTGGTGAGGGGATGCGGGCGCGG + Intronic
1148205763 17:45778944-45778966 CAGGAGATGGGATGAGGCTGGGG - Intergenic
1148690409 17:49523908-49523930 CAGGTGAGGGGTGGAGGCTGGGG + Intergenic
1148872751 17:50668355-50668377 CTGGGGATGGGGCGAGGGTAGGG + Intronic
1149424968 17:56546013-56546035 GGGGGGAGGGGAGGAGGGTGGGG + Intergenic
1150398104 17:64836802-64836824 CTGGTGAGGGGATGCGGGCGCGG + Intergenic
1150608356 17:66713447-66713469 CTGCAGGTGGGAGTAGGGTGGGG - Intronic
1150692307 17:67377282-67377304 CTGGGGCCGGGAGGTGGGTGCGG - Intronic
1151008948 17:70471843-70471865 CAGATGAGGGGAGGAGGGAGAGG - Intergenic
1151130619 17:71893107-71893129 CTGGTGGGGGGTGGGGGGTGGGG + Intergenic
1151244045 17:72780513-72780535 CTGAAGATGGGGGGCGGGTGGGG + Intronic
1151404663 17:73878563-73878585 CTGGGGTTGGGAGGTGGTTGTGG + Intergenic
1151496659 17:74462060-74462082 CTGGAGATGGGCGTGGGGTGAGG + Intergenic
1151718607 17:75843757-75843779 CTGGGGAAGGGAGGGAGGTGGGG - Intronic
1152022194 17:77785921-77785943 CAGCTGATGAGAGGAGTGTGAGG - Intergenic
1152109769 17:78351598-78351620 CTGGTGCCGGGAGGGGGATGGGG - Intergenic
1152330820 17:79671558-79671580 CTGGTGCTGGGAGGGGCCTGAGG - Intergenic
1152410584 17:80120632-80120654 CAGGTGAGGGGAGGAGGGGAGGG - Intergenic
1152498005 17:80688009-80688031 CTGCTGAGTGGAGGTGGGTGTGG - Intronic
1152726969 17:81952296-81952318 CTGGGGAGGGGAGGTGGGGGAGG + Intergenic
1152783269 17:82235813-82235835 CTGGTGGAGGCAGGAGGGTTTGG - Exonic
1152797826 17:82316626-82316648 CTGGGGTTGGGAGGGGGGTCTGG + Intronic
1152880503 17:82812057-82812079 CTGGTGATGGGAGTCAGGAGGGG - Intronic
1153260024 18:3215008-3215030 CTGCTGCTGGGAGGAGGAGGCGG + Exonic
1153261164 18:3225758-3225780 GGCGTGCTGGGAGGAGGGTGTGG - Intergenic
1153391798 18:4570127-4570149 CATGTGGTGGGAGGAGAGTGAGG - Intergenic
1153677432 18:7468113-7468135 CTGGTGTTGGGAGTAGGAAGAGG - Intergenic
1153854183 18:9128934-9128956 CGGGTGAGGGGAGGAGTGGGGGG - Intronic
1154168747 18:12035672-12035694 CTGGAGATGTGAGGGGGGTGGGG + Intergenic
1154371397 18:13765941-13765963 GTTGTGGTGGGAGGAGGCTGTGG - Intergenic
1155238716 18:23846105-23846127 CAGGTGGTAGGGGGAGGGTGTGG + Intronic
1155982244 18:32193751-32193773 CTGGGGGTGGGAGGACTGTGAGG - Intronic
1156003902 18:32417731-32417753 GTGGGGGTGGGAGGAAGGTGGGG + Intronic
1156319826 18:36008985-36009007 CTGGGTATGGGAGTAGGGAGAGG + Intronic
1156364950 18:36417205-36417227 TGGATGATGGGAGGAGGGAGAGG - Intronic
1156468584 18:37363177-37363199 GTGGGGAGGGGACGAGGGTGGGG + Intronic
1156527169 18:37778077-37778099 CCTGGGGTGGGAGGAGGGTGGGG + Intergenic
1157216958 18:45792192-45792214 CTTGTGGGGGGTGGAGGGTGGGG + Intergenic
1157480335 18:48049958-48049980 CTGGGCATGGGAGGAGGTGGAGG - Intronic
1157524825 18:48372848-48372870 CAGGAGATGGGAGTAGGGAGAGG - Intronic
1157968041 18:52231154-52231176 GTGGCCATGGGAGGAGGGAGGGG + Intergenic
1158063887 18:53381556-53381578 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1158391162 18:57046390-57046412 CTGGTGAGGGGAGGTGGGAAGGG + Intergenic
1158642778 18:59217913-59217935 ATGGGGATGGGAGGAGGTGGAGG + Intergenic
1158682412 18:59580667-59580689 CTGGTGTCTGGACGAGGGTGGGG + Intronic
1159334274 18:67043611-67043633 CAGGTGCTGGGAGCAGGGAGAGG - Intergenic
1159346446 18:67212858-67212880 GTGAAGATGGGAGGAGGGAGTGG - Intergenic
1159916588 18:74193734-74193756 GGGGTGATGGAGGGAGGGTGGGG - Intergenic
1160338295 18:78062671-78062693 CTGGGGAAAGGAGGAAGGTGGGG + Intergenic
1160491318 18:79338406-79338428 CTGCTGCTGGGAGCATGGTGGGG - Intronic
1160543989 18:79640797-79640819 CTTGTTACGGGAGGAGGGTGTGG - Intergenic
1160571101 18:79818235-79818257 CTCCTTCTGGGAGGAGGGTGGGG - Intergenic
1160725845 19:617481-617503 CTGGGGTTGGAAGCAGGGTGGGG + Intronic
1160756279 19:758521-758543 CTGGGGCTGGGAGGTGGCTGGGG + Exonic
1160970508 19:1765815-1765837 GTGGTGAGGGGAGCAGGGGGAGG + Intronic
1161154303 19:2724202-2724224 CTGGTCAGGGCAGCAGGGTGAGG - Intronic
1161249672 19:3273764-3273786 CTGGTGGTGGGAGGTGGGCAGGG + Intronic
1161314375 19:3611089-3611111 CTGGGGGTTGGAGAAGGGTGAGG - Exonic
1161861528 19:6801690-6801712 CTGGTGCTGGGGTGGGGGTGGGG + Intronic
1161872386 19:6880159-6880181 CAGGGGATGGGAGGTGGGAGGGG + Intergenic
1162044133 19:7987590-7987612 CTGGTGGCGGGAGGAAGGAGGGG - Intronic
1162104594 19:8362821-8362843 CGGGTGGTGGGAGGGGGGGGGGG - Intronic
1162500784 19:11052464-11052486 CAGGTGGAGGAAGGAGGGTGTGG - Intronic
1162876441 19:13624174-13624196 CTGATGCTGGGAGGAGGGAAAGG + Intergenic
1163264163 19:16208253-16208275 CTGGAGGTGGGAGGCAGGTGGGG - Intronic
1163314012 19:16530675-16530697 CTGGCGGTGGGAGGAGAGAGAGG + Intronic
1163392547 19:17039241-17039263 TTGGTGATGGGAGGAAGGAAGGG - Intergenic
1163401946 19:17099371-17099393 GTGATGGGGGGAGGAGGGTGAGG + Intronic
1163585381 19:18160986-18161008 ATGGGGTTGGGAGGAGGCTGGGG + Intronic
1163693535 19:18750699-18750721 CTGCTGATAGGAGGAGGAAGAGG + Intronic
1164382558 19:27747191-27747213 CCGGTGGCGGGAGGAGGGAGCGG + Intergenic
1164531483 19:29051650-29051672 GTGTGGAGGGGAGGAGGGTGAGG - Intergenic
1165403599 19:35617203-35617225 CTGGTCATGGGAGAAGGGGCAGG + Intronic
1165586780 19:36923843-36923865 GTGAAGGTGGGAGGAGGGTGGGG - Intronic
1165749371 19:38250987-38251009 CTGGGGATGGGGGTGGGGTGGGG + Intronic
1165811459 19:38614346-38614368 CTGGGGATGGGAGGGGAGGGTGG - Intronic
1165817047 19:38648594-38648616 CTGGGGGTCTGAGGAGGGTGGGG + Intronic
1166258467 19:41621614-41621636 CTAGGGGTGGGAGGAGGCTGGGG + Intronic
1166344003 19:42154100-42154122 CTTGTGGTGGGGGGAGGGCGGGG - Intronic
1166677297 19:44747927-44747949 CTGGGGGTGGGGTGAGGGTGGGG - Intronic
1166853858 19:45772753-45772775 CTGGGGAGAGGAGGAGGGAGTGG + Intronic
1166892169 19:46000405-46000427 CTGGTGTAGGGAGGAGAGTGCGG + Intronic
1166959968 19:46491474-46491496 CAGGTGAGGGGTGGAGGCTGGGG + Exonic
1167120320 19:47512904-47512926 CTGGGGATGGGAAGAGACTGTGG - Intronic
1167144951 19:47676018-47676040 CTGTTGACAGGAGGAGGGCGGGG + Intronic
1167284148 19:48589303-48589325 CTGGGAAGGGGAGGAGGGAGGGG + Intronic
1167418155 19:49388052-49388074 CTGGTGGTGGAAGGAGGGGGTGG - Intergenic
1167419674 19:49395523-49395545 CTGGAGAAGGGAGGAGTTTGGGG + Intronic
1167666215 19:50823908-50823930 CTGGGGATCGGAGGGGGGGGGGG - Intergenic
1167702737 19:51060156-51060178 TTGGGGATGGGAAGAGGTTGGGG - Intronic
1167751354 19:51382282-51382304 GTGGGGATGGGATTAGGGTGGGG + Intronic
1168059369 19:53882662-53882684 CTGGTGAGGGAAGGGGGCTGGGG + Exonic
1168063000 19:53904552-53904574 CCGGTGGGGTGAGGAGGGTGTGG + Intronic
925057377 2:865706-865728 CTGTTTATGGGAGGAGGGCAGGG + Intergenic
925132892 2:1505729-1505751 CTGTTGAGGGGTGGAGGATGAGG - Intronic
925139870 2:1542852-1542874 CTGGTGATGGGCAGGGGGTGTGG - Intronic
925253319 2:2461116-2461138 CTGGTGAAGGAAGGAGGGTGGGG - Intergenic
925347803 2:3183028-3183050 ATGGTGAGTGGATGAGGGTGAGG - Intergenic
925564884 2:5240281-5240303 CTGGAGAAGTGTGGAGGGTGAGG - Intergenic
926106274 2:10153877-10153899 CTGGGGAGGGGAGAAGGGAGAGG + Intronic
926205859 2:10834012-10834034 CTGGGGATGGGGGAAGGGAGAGG - Intronic
926332075 2:11833904-11833926 CTGGTGAGAGGAGCAGGGTCTGG - Intergenic
927148862 2:20184463-20184485 CTGGTGCTTTGAGGAGGGTGGGG + Intergenic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
927183788 2:20467747-20467769 CTGGTGGGAGGAGGAAGGTGAGG + Intergenic
927554082 2:24020439-24020461 CTGGGGAGGGGAGGAGAGGGAGG - Intronic
927576852 2:24207742-24207764 CTGGTGAAGTGAGAAGGGGGAGG + Intronic
927762742 2:25774111-25774133 GTGGAGGTGGAAGGAGGGTGAGG + Intronic
927962380 2:27249180-27249202 CTGGTGATGGAAGGAATGGGTGG - Intergenic
928339867 2:30433731-30433753 CTGCTGAGGGGAGGAGGTAGGGG - Intergenic
928391869 2:30916615-30916637 CTGCTGGTGGGAGCAGGGAGGGG + Intronic
928398954 2:30964386-30964408 GTGGTGAGGGGAGGAGCGTCTGG - Intronic
928585813 2:32756894-32756916 ATGGTGGTGGGAGGAAGTTGAGG + Intronic
928871581 2:35987278-35987300 CTGGTGATGGGAGTTAGGGGTGG - Intergenic
929084321 2:38153409-38153431 CAAGTGATGGGAGGTGGGAGTGG + Intergenic
929207838 2:39318243-39318265 TTGAGGTTGGGAGGAGGGTGAGG + Intronic
929442265 2:41973425-41973447 CTGGGGAAGGGAGGAGGTTATGG + Intergenic
929553146 2:42906891-42906913 ATGGAGATGGAAGGAGGGAGTGG - Intergenic
929664514 2:43823277-43823299 CTGGTGGTGGGGGCGGGGTGGGG - Intronic
929827559 2:45321214-45321236 CTGTAGGTGGGAGGAGGGAGAGG - Intergenic
929847228 2:45542289-45542311 CGGGTGCTGGGAGCAGGGAGAGG + Intronic
930081678 2:47454834-47454856 CTGTTGAGGGGTGGAGGGAGGGG - Intronic
930307338 2:49692004-49692026 CTGTTGCGGGGTGGAGGGTGAGG - Intergenic
930971257 2:57397949-57397971 CAGGTGCTGGGAGCAGGGAGAGG + Intergenic
931460881 2:62449037-62449059 CTGGTGCTGGGACAAGGGTATGG - Intergenic
931580533 2:63767001-63767023 CTGGGGATGGGGTGAGGGTGGGG - Intronic
931709434 2:64975464-64975486 CTGGGCATGGGAGGAGGGTGTGG + Intergenic
931778965 2:65563764-65563786 CAGGTGATGGCAGCAGTGTGGGG + Intergenic
931925791 2:67071155-67071177 CTGGGGATGGCAGGTAGGTGGGG - Intergenic
931972819 2:67608467-67608489 ATGGTGGTGTGAGGAAGGTGGGG + Intergenic
932084773 2:68748159-68748181 CTGTTAATAGAAGGAGGGTGTGG - Intronic
932485832 2:72083864-72083886 CTGGTGACGAAGGGAGGGTGGGG + Intergenic
932699586 2:73984271-73984293 CTGGTGATGGCAGGGCCGTGGGG + Intergenic
932815731 2:74860164-74860186 AGGGTGAGGGTAGGAGGGTGGGG + Intronic
933207873 2:79529995-79530017 CTGGTGATGAGAAGAGACTGTGG + Intronic
933316912 2:80726753-80726775 CTGCTGCTGGGTGGGGGGTGGGG - Intergenic
933882037 2:86679123-86679145 CTGGAGTTGGGAGCAGGGGGTGG + Intronic
934149848 2:89135794-89135816 CTGGTGATGCTGGGAGGCTGAGG + Intergenic
934458116 2:94192377-94192399 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
934552720 2:95271948-95271970 CTGGGGATGGGTGGAGGCAGGGG + Intergenic
935710281 2:105892600-105892622 CTGAGGCTGGGAGGGGGGTGGGG + Intronic
936061096 2:109296175-109296197 CAGGAGATGGGAGGAGGCTCTGG - Intronic
936400324 2:112159925-112159947 AAGGTGATGGGGGAAGGGTGAGG - Intronic
937019423 2:118636639-118636661 CTGTTGAGGGGTGGGGGGTGAGG - Intergenic
937027686 2:118712749-118712771 TTGTTGATGGCAGGAGGATGTGG - Intergenic
937148438 2:119668298-119668320 CTGTTGGTGGGTGGCGGGTGAGG + Intergenic
937307941 2:120883806-120883828 CTGGTGGTGGGGGTAGGGAGTGG + Intronic
937349411 2:121150942-121150964 CTGGAGACGTGAGAAGGGTGAGG - Intergenic
937437243 2:121890578-121890600 CTGGGGGTGGGGAGAGGGTGGGG - Intergenic
937466647 2:122138778-122138800 CTGGTGCTGGCAGGTGGGAGGGG - Intergenic
937672806 2:124556828-124556850 CAGGTGGTGGGGGCAGGGTGAGG + Intronic
937831068 2:126424209-126424231 TAGAGGATGGGAGGAGGGTGAGG + Intergenic
937894694 2:126969826-126969848 CTGGTGTTTGGAGGCAGGTGGGG - Intergenic
937977454 2:127590227-127590249 CTGGTAATGACAGGAGGCTGGGG + Exonic
938380801 2:130835595-130835617 ATGGTGGTGGGAGGAGGGTGTGG - Intergenic
938631558 2:133173180-133173202 TTGGGGATGGCAGGAGGTTGGGG + Intronic
938812440 2:134866126-134866148 ATGAGGGTGGGAGGAGGGTGAGG + Intronic
940384933 2:153059269-153059291 TTTGTGATGGGAGAAGGATGGGG + Intergenic
940704138 2:157082785-157082807 GCCGTGATGGGAGGAGGGTTTGG + Intergenic
941588125 2:167384960-167384982 GTGGTGGTGGGAGGAGACTGAGG - Intergenic
941890234 2:170572633-170572655 CTGTTGGTGGGAGGAGGAGGAGG - Intronic
942045589 2:172097476-172097498 CTGGTTTCGGGAGGAGGGAGGGG + Intergenic
942114436 2:172713635-172713657 CGGGTGCTGGGAGCAGGGAGAGG + Intergenic
942408082 2:175676719-175676741 CTGGGGCTGGGAGCAGGGTCAGG - Intergenic
942763604 2:179428436-179428458 TTGGTGATGGGAGGGGGCAGAGG + Intergenic
943196133 2:184752481-184752503 TGGGGGATAGGAGGAGGGTGAGG + Intronic
943233131 2:185283070-185283092 TTGGTGGTGGCAGGAGGTTGAGG + Intergenic
943827429 2:192414042-192414064 CTGGCGCTGGGAGCAGGGAGAGG - Intergenic
944068701 2:195646614-195646636 GTGGTGGGGGGAGGTGGGTGGGG - Intronic
945119820 2:206445284-206445306 CTGGTGGAGGTAGGGGGGTGGGG - Intronic
945339364 2:208633261-208633283 CTGGAGGTGGCAGGGGGGTGTGG - Intronic
945555258 2:211267896-211267918 CTGGTGTGGGGCGGGGGGTGGGG - Intergenic
945829187 2:214762880-214762902 GTAGTGGTGGGAGGGGGGTGGGG - Intronic
945942306 2:215961825-215961847 CTGGTGATGGGAGCAGCAGGTGG - Intronic
946188299 2:217994136-217994158 CTGGGGCTGGGGTGAGGGTGGGG + Intronic
946276511 2:218635723-218635745 CTGGGGTTGGGAGTAGGGTCGGG + Intronic
946328674 2:218997782-218997804 CTGGTGATGGTGGCAGGGTGAGG - Intergenic
946364161 2:219238201-219238223 CTGGGGAAGGGAGGAGTTTGGGG + Intronic
946374476 2:219299787-219299809 CTGGAGATGGGAGAAGGCAGAGG + Intronic
946412194 2:219521047-219521069 CTGGTGTGGGGTGGAAGGTGGGG - Intronic
946584553 2:221170240-221170262 CTGGGGAAGGGAGCATGGTGTGG - Intergenic
946660284 2:221992246-221992268 CTGGAGATGAGAGGAGGGAAAGG - Intergenic
946756925 2:222956751-222956773 GTGGGGGTGGGAGCAGGGTGAGG - Intergenic
947101415 2:226625306-226625328 CTGGTGTTGGAAGTGGGGTGTGG - Intergenic
947382955 2:229563119-229563141 ATGGTGATGGGATGAGGAGGAGG - Intronic
947382969 2:229563203-229563225 ATGGTGATGGGATGAGGAGGAGG - Intronic
947382983 2:229563287-229563309 ATGGTGATGGGATGAGGAGGAGG - Intronic
947383200 2:229564627-229564649 GTGGTGATGGGGTGAGGATGAGG - Intronic
947774035 2:232693670-232693692 TTGAGGATGGGAGGAGGGTAAGG - Intergenic
947856642 2:233328665-233328687 CTGGTGAAGAGAGGGGTGTGGGG - Intronic
947908969 2:233789444-233789466 CTTGTGCTGGGGGCAGGGTGAGG + Intronic
948005402 2:234603964-234603986 GTGGTGGTGGGAGGAGGTTGAGG + Intergenic
948646462 2:239408042-239408064 CAGGTGAGGGCAGGAGGCTGAGG + Intergenic
948658444 2:239491590-239491612 CTGGTGATGGGCAGAGAGTTTGG + Intergenic
948752872 2:240142541-240142563 ATGCAGAGGGGAGGAGGGTGAGG + Intronic
948802676 2:240440008-240440030 CCGGGGATGGGATGGGGGTGGGG - Intronic
948893360 2:240917398-240917420 CTGGGGTTGGGAGGAGGGTGGGG + Intergenic
1168826511 20:818061-818083 TTGGAGATGGGGGGAGGCTGGGG + Intergenic
1169141820 20:3230902-3230924 CTGGCGGTGGGCGGTGGGTGGGG - Intronic
1169235153 20:3924762-3924784 CTGGGTACTGGAGGAGGGTGAGG - Intronic
1169725430 20:8724064-8724086 GTGGAGGTGGGAGGAGGGAGAGG + Intronic
1170194838 20:13679408-13679430 CTGGTGGTGGGAGGTGGGGGTGG + Intergenic
1170578234 20:17680772-17680794 CTGGACACGGGAGGAAGGTGGGG - Intronic
1170998134 20:21385687-21385709 CAAGTGAAGGGAGGAGAGTGGGG + Intronic
1171248159 20:23629730-23629752 CTGGTGGGGGGGGGAGGGGGTGG + Intronic
1171265319 20:23766886-23766908 CAGGTGGTGAGAGGAGGGTGTGG + Intergenic
1171282493 20:23912394-23912416 CAGGGGGTGAGAGGAGGGTGGGG + Intergenic
1172125117 20:32621114-32621136 CTGGGGTGGGGAGGAGGCTGGGG + Intergenic
1172221142 20:33275956-33275978 CTGGAGATGGGGTGGGGGTGGGG + Intronic
1172227094 20:33312287-33312309 CTGGTGATGTGATGGGGCTGGGG + Intergenic
1172414903 20:34757437-34757459 CTGCTGGAAGGAGGAGGGTGAGG + Exonic
1172468090 20:35171998-35172020 CAGGAGATGGGAGGAGGAAGAGG - Intergenic
1172525836 20:35600349-35600371 CTGGGGCCGGGAGGAGGGAGAGG - Intergenic
1172780313 20:37432916-37432938 CTGATGATGGAAGGAGAGAGGGG - Intergenic
1172803416 20:37594287-37594309 GTGGTGACGGGAGAAGGTTGTGG + Intergenic
1172807521 20:37623012-37623034 CTGGTCCTGGGAGGAGGAGGGGG + Intergenic
1172841062 20:37903064-37903086 CGGGAGGAGGGAGGAGGGTGCGG + Intergenic
1172846266 20:37931514-37931536 CGGGGGATGGGTGGAGGGGGTGG - Intronic
1172896315 20:38302857-38302879 ATGGTGATGAGAGGAGGGGCGGG - Intronic
1172914898 20:38436195-38436217 CTGGAGCGGGGCGGAGGGTGGGG - Intergenic
1173697561 20:45032409-45032431 CAGAGGGTGGGAGGAGGGTGAGG - Intronic
1173871896 20:46347555-46347577 CTAGTGATGGACTGAGGGTGGGG - Intronic
1173946880 20:46958679-46958701 GTGGTGGTGGGAGGTGGGAGAGG - Intronic
1173959266 20:47058481-47058503 CTGGTGATGGCAGGAGAGAGAGG + Intronic
1174331600 20:49824039-49824061 GGGGTGATGGGAGGAGGGGGAGG - Intronic
1174338739 20:49883011-49883033 ATGGTGGGGGGAGGGGGGTGGGG - Intronic
1174779339 20:53374132-53374154 AGGGTGAAGGGAGGAGGGTGAGG - Intronic
1175112518 20:56658479-56658501 TTGGTGAGGGGTGGAGGTTGGGG + Intergenic
1175229027 20:57461832-57461854 CTAGGGAGGGGAGGAGGATGTGG - Intergenic
1175431779 20:58910152-58910174 TTGGTGGTGGGAGGGGGATGGGG - Intronic
1175465019 20:59185007-59185029 CTGGGGATGGCAACAGGGTGAGG + Intergenic
1175538534 20:59733098-59733120 CTGGTGTTGGGTGGAGGGCAGGG - Intronic
1175782309 20:61690429-61690451 CAGGTGATGCCAGGAGGGAGGGG + Intronic
1175789480 20:61732466-61732488 CTGAGGATGGGAGGAGACTGGGG - Intronic
1175806042 20:61829919-61829941 CTGGGGCTGGGAGGCAGGTGTGG + Intronic
1176078998 20:63262360-63262382 GAGGTGACGGGAGGACGGTGGGG - Intronic
1176079010 20:63262400-63262422 GAGGTGACGGGAGGACGGTGGGG - Intronic
1176079022 20:63262440-63262462 GAGGTGAAGGGAGGACGGTGGGG - Intronic
1176079034 20:63262480-63262502 GAGGTGATGGGAGGACGGTGGGG - Intronic
1176079046 20:63262520-63262542 GAGGTGAAGGGAGGACGGTGGGG - Intronic
1176079057 20:63262560-63262582 GAGGTGATGGGAGGACGGTGGGG - Intronic
1176409129 21:6438264-6438286 CTGGGGAGGTGTGGAGGGTGAGG - Intergenic
1176514450 21:7773785-7773807 CTGGTGATGGGGGCTGGGTGTGG + Intergenic
1178212098 21:30547424-30547446 TGGGTGATGGGAGGAGGGTAAGG - Intronic
1178484909 21:33012933-33012955 CTGGTGCGGGGAGGAGACTGAGG - Intergenic
1178534022 21:33397895-33397917 CTGGTGAAAGGAGGGGGCTGTGG + Intergenic
1178648563 21:34404309-34404331 CTGGTGATGGGGGCTGGGTGTGG + Intronic
1178824641 21:36004984-36005006 CAGGGGAAGGGAGGAGGGGGAGG + Intergenic
1179047813 21:37861905-37861927 CTGGAAAGGAGAGGAGGGTGTGG + Intronic
1179090268 21:38258748-38258770 CTGTTGGTGGGAGGAAGGAGTGG - Intronic
1179269798 21:39841664-39841686 GGGGCGATGGGAGGAGGATGGGG + Intergenic
1179537419 21:42061526-42061548 TGGGTGGTGGGAGGAGGGTATGG - Intergenic
1179684622 21:43046586-43046608 CTGGGGAGGTGTGGAGGGTGAGG - Intergenic
1179992317 21:44954427-44954449 ATGGTGTTGGCTGGAGGGTGGGG + Intronic
1180068378 21:45424089-45424111 CTGGTGCTGGGGGGAGGGTAGGG + Intronic
1180163115 21:46006819-46006841 CAGGGGCTGGGAGGAGGCTGGGG + Intergenic
1180176109 21:46090746-46090768 ATGGTGATGGGGTGATGGTGTGG + Intergenic
1180176132 21:46090872-46090894 ATGGTGATGGGGTGATGGTGTGG + Intergenic
1180185034 21:46135282-46135304 CTGGTGAGGGGATGCTGGTGTGG - Intergenic
1180655798 22:17419382-17419404 CTGGGGATTGGAGGAGGTTGTGG + Intronic
1181323034 22:22023198-22023220 AGGGCGATGGGTGGAGGGTGAGG + Intergenic
1181358094 22:22314050-22314072 CTGAGGATGGAAGAAGGGTGCGG + Intergenic
1181359444 22:22323385-22323407 AGAGTGATGGGAGGAGGGTGAGG - Intergenic
1181441102 22:22935578-22935600 CCTGAGATGGGAGTAGGGTGGGG + Intergenic
1181506474 22:23361741-23361763 CTGGTGATGGAAGGGGTGGGTGG - Intergenic
1181519581 22:23437380-23437402 CTGGGGCGGGGAGGAGGCTGGGG - Intergenic
1181727247 22:24820119-24820141 CTGGGGATAGAAGGAGGCTGGGG + Intronic
1181771100 22:25126229-25126251 CTGGTGATGGTGGGAACGTGAGG - Intronic
1181988638 22:26820084-26820106 CTGGTGGGGGGCGGGGGGTGGGG - Intergenic
1181999098 22:26905521-26905543 TTGAGGATGGGAGGAGGGAGTGG + Intergenic
1182078203 22:27509566-27509588 GTGGAGAAGGGAGGAGGATGTGG - Intergenic
1182096846 22:27631168-27631190 GGGGTGGTGGGAGGTGGGTGGGG - Intergenic
1182409428 22:30170662-30170684 ATGGTGGTGGGAGCAGGGGGAGG - Intronic
1182705828 22:32279830-32279852 GTGGTGCTGGGAGGAGGGTCTGG - Intergenic
1183266498 22:36829596-36829618 CTGGTGTGGGGTGGGGGGTGAGG + Intergenic
1183294389 22:37021024-37021046 CTGGTGGTTGGGGGAGGGGGTGG + Intronic
1183314500 22:37129461-37129483 CTGGGGATGGGAGGCGGAGGGGG - Intronic
1183539136 22:38419468-38419490 CTGGTGACAGGCGGAGGGTCAGG + Intergenic
1183639335 22:39083621-39083643 CGGGGGAAGGAAGGAGGGTGGGG + Intronic
1183731033 22:39618718-39618740 CTGGTGATGGGGGGCAGGGGGGG + Intronic
1183856821 22:40640231-40640253 GTGGAGATGGGTCGAGGGTGTGG - Intergenic
1184271586 22:43387499-43387521 CTGATGAAGGGAGGTGGGTGGGG + Intergenic
1184394160 22:44222900-44222922 GTGGTGCTGGGAGGAGGGTCTGG - Intergenic
1184820694 22:46907523-46907545 CTGGAGAAGGGAGGAAGGGGAGG + Intronic
1184849768 22:47113411-47113433 CTGGTGGTGGGAGGTGGGGTGGG + Intronic
1184865912 22:47201869-47201891 CAGGTGCTGGGAGCAGGGAGAGG + Intergenic
1184880153 22:47299536-47299558 CTTGGGGTGGGAGAAGGGTGGGG - Intergenic
1185040400 22:48501075-48501097 CTGGTGGCGGGGGAAGGGTGGGG - Intronic
1185041978 22:48508958-48508980 CTGGAGAGGGGAGGAGGCTAGGG - Intronic
1185253801 22:49820488-49820510 CTGAGGCTGGGAGGAGGCTGAGG + Intronic
949378593 3:3418707-3418729 CTGGGAATGGTAGGAGGGAGAGG - Intergenic
950362379 3:12458886-12458908 CTGGGGAGGGCAGAAGGGTGGGG + Intergenic
950453206 3:13077348-13077370 ATGGGGATGGGAGGAGGGCAGGG - Intergenic
950472298 3:13193777-13193799 CAGGTGCAGGCAGGAGGGTGTGG - Intergenic
950653531 3:14422641-14422663 CTCTGGCTGGGAGGAGGGTGGGG - Intronic
950871225 3:16231135-16231157 CTGTTGAGGGGTGGGGGGTGGGG + Intronic
951590149 3:24255703-24255725 CTGGTGTAGGCAGAAGGGTGAGG + Intronic
951819768 3:26795077-26795099 CTGTGGTTGGGAGGAGGGAGAGG + Intergenic
952088398 3:29854148-29854170 CTGGAGCTGGGAGGAGGCTGGGG - Intronic
952701430 3:36332320-36332342 CTGGAGATGGGATGTGGTTGAGG - Intergenic
953863409 3:46564263-46564285 CTGGGTTGGGGAGGAGGGTGTGG - Intronic
954400522 3:50317301-50317323 CTGGTGGTGGGAGGTGGGCAGGG - Intergenic
954445286 3:50543012-50543034 GTGGAGCTGGGAGGTGGGTGCGG + Intergenic
954663600 3:52238898-52238920 CTGGTGTGGGGTGGAGGGAGGGG + Intronic
954665243 3:52248063-52248085 CTGGTGGTTGGAGGAGGGACTGG + Intronic
954777148 3:53029787-53029809 CATGTGGTGGGTGGAGGGTGGGG + Intronic
954817188 3:53292049-53292071 CAGGTAATGGCAGGAGGGTGGGG - Exonic
954844825 3:53546252-53546274 CTAGTGCTGGGAGGGAGGTGTGG + Intronic
954854086 3:53627603-53627625 CTGTGGATGGGTGGGGGGTGGGG + Intronic
954932272 3:54294556-54294578 CTGGTGGTGTGGGGAGTGTGTGG + Intronic
954934412 3:54313500-54313522 CTGATGTGGGGAGGTGGGTGGGG - Intronic
955095228 3:55790422-55790444 GTGCTGACGGGATGAGGGTGAGG - Intronic
955525324 3:59813894-59813916 TTGGTGATGGTAGCAGGGTGTGG + Intronic
955929524 3:64042511-64042533 TTAGGTATGGGAGGAGGGTGAGG - Intergenic
956718001 3:72095240-72095262 CTGTTGAGGGGTGGAGGGTGAGG + Intergenic
956888730 3:73588082-73588104 CTGTTGAGGGGTGGAGGGTGAGG - Intronic
956991506 3:74771725-74771747 ATGGGGAAGGGAGGAGAGTGGGG + Intergenic
957087222 3:75692335-75692357 CTGCTGCTGGGTGGGGGGTGGGG - Intergenic
957201838 3:77146209-77146231 CAGGTGCTGGGAGCAGGGGGCGG - Intronic
957763233 3:84587262-84587284 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
958403735 3:93726227-93726249 CTGTTGTCGGGTGGAGGGTGGGG - Intergenic
958898749 3:99861074-99861096 GTGGTGGTGGGAGCAGGGGGTGG - Intronic
959105936 3:102064078-102064100 TTGGTGAGGGTAGGAGGGTGGGG - Intergenic
959484142 3:106908416-106908438 CTGGAGTTGCCAGGAGGGTGGGG + Intergenic
959570365 3:107876578-107876600 CTGGGGCTGGGAGCTGGGTGGGG + Intergenic
959636792 3:108583602-108583624 GTGGTGATGGGAGGTGTGAGGGG + Intronic
959887569 3:111520260-111520282 GTGGTGATGTTAGGAGGCTGAGG - Intronic
960047706 3:113212942-113212964 CAGGTGATGGGAGAATGCTGAGG + Intronic
960127638 3:114017728-114017750 CTGTTGAGGGGTGGAGGATGAGG + Intronic
960501994 3:118449132-118449154 CAGGGGTTGGGAGGAGGGAGAGG - Intergenic
960637175 3:119795297-119795319 AGGGGGATGGGAAGAGGGTGGGG + Intronic
961007553 3:123415063-123415085 CTGGTGATGTGGGGTGGCTGTGG - Intronic
961026249 3:123560528-123560550 GTGGTGATGGCAGGGGGATGGGG - Intronic
961461695 3:127054189-127054211 CTGGTGTTGGCAGAAGGCTGTGG + Intergenic
961753357 3:129111046-129111068 ATGGTGATGGGTGGAAGGTGAGG - Intronic
961948051 3:130714601-130714623 CTGTTGAGGGGTGGGGGGTGAGG - Intronic
962143019 3:132810471-132810493 CTGGAGATGGGGTGTGGGTGAGG - Intergenic
962490051 3:135884440-135884462 CGTGAGATGCGAGGAGGGTGAGG - Intergenic
962632010 3:137286823-137286845 CTGGAGATGGGGGCAGGGTGAGG - Intergenic
962736272 3:138328344-138328366 CTGGGGGTGGGAGGGGTGTGGGG - Intronic
963066954 3:141271685-141271707 ATGGGGATGGCAGGAGGGAGGGG + Intronic
963317009 3:143770493-143770515 CTTGTGTTGGGAGGAGTCTGGGG + Intronic
964392591 3:156213095-156213117 CTGGTGATGGGCTGAGTATGGGG + Intronic
964704836 3:159606935-159606957 CTGGTGACAGGAGGAAGGAGTGG + Intronic
965310744 3:167124874-167124896 CTGGTGCTTGTCGGAGGGTGGGG + Intergenic
965415315 3:168385219-168385241 CTGCTGCTGGGAGGTGGGAGAGG + Intergenic
965540409 3:169865915-169865937 CTGGGGATGGGAGAAGAATGTGG + Intronic
965597252 3:170421145-170421167 CTGGGGGTGGGGGGGGGGTGGGG + Intronic
965686557 3:171309406-171309428 TGGAGGATGGGAGGAGGGTGAGG + Intronic
965695244 3:171401309-171401331 CTGGTGAGGTGAGGAGGAGGAGG - Intronic
965731294 3:171774803-171774825 AGGGTGGTGGGAGGAGGGTGGGG + Intronic
966332127 3:178826166-178826188 GTGGAAAAGGGAGGAGGGTGGGG - Intronic
966661243 3:182417414-182417436 CTTGTGATGGGAAGAGGGAAAGG - Intergenic
966984206 3:185164820-185164842 CTGGAGAAGTGAGGAGGGAGGGG - Intergenic
967095892 3:186176899-186176921 CTGGTGATGGGGAGAGGTTTGGG + Intronic
967318048 3:188168965-188168987 CTTGGGATGGGAGGTGGGGGAGG - Intronic
967575303 3:191082912-191082934 CAGGGGGTGGGAGGAGGGAGAGG + Intergenic
967943928 3:194787223-194787245 GTGGGGATGGGGTGAGGGTGGGG + Intergenic
968171900 3:196517507-196517529 ATGGTGCTGGGGAGAGGGTGTGG + Intergenic
968771732 4:2511807-2511829 CTGTGGGTGGGAGGAGGGTGGGG + Intronic
969105105 4:4801603-4801625 GTGGTAATGGGAGGAGGCTGGGG - Intergenic
969226270 4:5800533-5800555 CTGGTGAAGGGAGGAGAGGTGGG + Intronic
969426708 4:7128645-7128667 CTGGTGCGGGGAGGAAGGGGAGG + Intergenic
969448312 4:7257865-7257887 CAGGAGATGGGAGGAAGGCGAGG + Intronic
969564611 4:7970632-7970654 AGGGTGTTGGGAGGTGGGTGTGG + Intronic
969624916 4:8297522-8297544 GGGGTGCTGGGAGGAGGCTGGGG + Intronic
969625668 4:8304096-8304118 CTGGTGCTGGAGGGAGGGAGGGG + Intronic
969629840 4:8329747-8329769 CTGGAGAAGGGAGGAGAGAGTGG - Intergenic
969704064 4:8782580-8782602 CTGGAGTAGGGAGGAGGGAGTGG + Intergenic
969837698 4:9856963-9856985 TGAGGGATGGGAGGAGGGTGAGG + Intronic
970204429 4:13641850-13641872 GTGGTGGTGGGAGGAAGGGGTGG + Intergenic
970553667 4:17209756-17209778 TTGGGGGTGGGAGGAGGGAGAGG + Intergenic
971763704 4:30802724-30802746 GTGGGGATCTGAGGAGGGTGTGG + Intronic
972169749 4:36331594-36331616 GTGGGAATGGGAGGAGTGTGAGG + Intronic
972225980 4:37012510-37012532 CTGGGAAGGGGAGTAGGGTGAGG + Intergenic
973566041 4:52188641-52188663 CAGAGGGTGGGAGGAGGGTGAGG - Intergenic
973656942 4:53057545-53057567 CTGTTGAGGGGTGGGGGGTGAGG + Intronic
973914095 4:55615770-55615792 GTGGAGGTGGGAGGAGGGAGAGG - Intronic
974377547 4:61097736-61097758 CTGTTGTTGGGTGGAGGGAGGGG - Intergenic
974961007 4:68700227-68700249 CAGGGGATGCGAGGAGGGAGAGG + Intergenic
975158383 4:71097160-71097182 TGGATGATGGGAGGAGGGAGAGG - Intergenic
976450285 4:85181685-85181707 CGGGGGATGGGAGGGGGGTGAGG - Intergenic
976662552 4:87554808-87554830 CAGGGACTGGGAGGAGGGTGGGG - Intergenic
977959091 4:103064488-103064510 CTGGGGAGGGGAGGAGCTTGGGG + Intronic
978007287 4:103632532-103632554 CTGTTGGTGGGTGGGGGGTGAGG + Intronic
978115440 4:105014838-105014860 CTGGTGATGGTAGGAGAGGCAGG - Intergenic
978160951 4:105547359-105547381 TTTTGGATGGGAGGAGGGTGAGG + Intergenic
978314697 4:107422692-107422714 GGGGTGATGGGAGGAGGGTAAGG + Intergenic
978533168 4:109734370-109734392 CTGCTGATATGAGGAAGGTGAGG + Intergenic
978620691 4:110632545-110632567 CCGGGGACGGGAGGAGGGGGAGG + Intronic
978753288 4:112276273-112276295 CTGTTGCTGGGAGGAAGGGGAGG - Exonic
979523179 4:121691533-121691555 CTGGAGGTGGGGGGAGGGTGCGG - Intronic
979679472 4:123443938-123443960 TTGGTGATGGGGGAAGGGAGTGG + Intergenic
980689335 4:136273920-136273942 TGGGGGATGGGAGAAGGGTGAGG + Intergenic
980729894 4:136811941-136811963 CTGGAGTTGGGAGCAGGGAGAGG + Intergenic
980738167 4:136917748-136917770 CTGCTGTTGTGGGGAGGGTGGGG - Intergenic
981001589 4:139833796-139833818 CTACTGATGGGATGGGGGTGGGG + Intronic
981357237 4:143803414-143803436 CTGCTGTTGGGTGGGGGGTGTGG + Intergenic
981645178 4:146991130-146991152 GTGGTGATGGCAGTATGGTGTGG + Intergenic
981868262 4:149454469-149454491 TTGGGAGTGGGAGGAGGGTGAGG + Intergenic
982868252 4:160544309-160544331 CTGGAGATGGGATTTGGGTGGGG + Intergenic
983585731 4:169352694-169352716 CTTGGGATGGGAGGAGGGAATGG + Intergenic
983631881 4:169857422-169857444 CAGGGGCTGGGAGGAGGGGGAGG + Intergenic
984396451 4:179207652-179207674 TGGATGATGGGAGGAGGGTAAGG - Intergenic
984539825 4:181023583-181023605 CACGTGATGGAAAGAGGGTGAGG - Intergenic
984757836 4:183340397-183340419 GGGGTAATGGGAGGAGGATGAGG - Intergenic
984905490 4:184622105-184622127 CTGGGGGTTGGTGGAGGGTGAGG - Intergenic
985101831 4:186466098-186466120 CGGGTGGGGGGAGGGGGGTGCGG - Intronic
986102187 5:4623148-4623170 CTGGAGTGGGGAGGGGGGTGGGG + Intergenic
987018552 5:13846272-13846294 GTGGAGGTGGCAGGAGGGTGAGG - Intronic
987089562 5:14498870-14498892 CTGTTGCTGGGAGGAGGATGGGG + Intronic
987158993 5:15120595-15120617 CTGGCATTGGGAGGAGGGGGTGG - Intergenic
987638382 5:20577503-20577525 TGGGTGATGGGAGAGGGGTGTGG + Intergenic
988348417 5:30069907-30069929 CTGGTGGGGGGCCGAGGGTGTGG - Intergenic
988497603 5:31758333-31758355 CTGGAGATGGAATGAGGGTTGGG + Intronic
988796585 5:34657234-34657256 CTGGTGGGGGGTGGGGGGTGGGG + Intronic
988856084 5:35229560-35229582 CTGGAGAAGGGAGGAGGGAAGGG - Intronic
988976284 5:36519458-36519480 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
989208950 5:38841213-38841235 CTACTGGAGGGAGGAGGGTGAGG - Intergenic
989242774 5:39219615-39219637 CTGGTCAGGGGAGGGAGGTGTGG - Intronic
989421389 5:41242990-41243012 CTGGGGATGGGAGGAGGAATGGG + Intronic
989425492 5:41291068-41291090 CAGGTGCTGGGAGGAGGGAGAGG + Intergenic
989560469 5:42844456-42844478 CTGTTGTTGGGTGGAGGGAGGGG - Intronic
989822057 5:45804964-45804986 CGGGGGGTGGGAGGAGGGAGAGG - Intergenic
990260995 5:54022320-54022342 CAGGGGACTGGAGGAGGGTGAGG - Intronic
990289180 5:54331319-54331341 TTGGTGGTGGGCGGGGGGTGGGG - Intergenic
990448722 5:55916516-55916538 CTGGGCCTGGGAGGAAGGTGGGG + Intronic
990486370 5:56262965-56262987 CTGGGGATGGGATGAGAGGGTGG + Intergenic
990703869 5:58505137-58505159 CTGGTGAGGGGAAGAGGGAGGGG + Intergenic
990743344 5:58934597-58934619 CTGTTGTTTGGAGGAGGCTGGGG - Intergenic
991095934 5:62739661-62739683 CTGGGGATGGGATGAAGGTAAGG + Intergenic
991293894 5:65060948-65060970 CAGCTGATGGGAGCAGGGAGAGG + Intergenic
991459007 5:66836791-66836813 TTGAGGTTGGGAGGAGGGTGAGG + Intronic
991539788 5:67714727-67714749 CAGGTGGTGGGAGGAGGGAGAGG - Intergenic
991743810 5:69710630-69710652 CGGGGGCGGGGAGGAGGGTGAGG + Intergenic
991753903 5:69844612-69844634 CGGGGGCGGGGAGGAGGGTGAGG - Intergenic
991795382 5:70290362-70290384 CGGGGGCGGGGAGGAGGGTGAGG + Intergenic
991803528 5:70401367-70401389 CGGGGGCGGGGAGGAGGGTGAGG - Intergenic
991823177 5:70585898-70585920 CGGGGGCGGGGAGGAGGGTGAGG + Intergenic
991833215 5:70719725-70719747 CGGGGGCGGGGAGGAGGGTGAGG - Intergenic
991887749 5:71289881-71289903 CGGGGGCGGGGAGGAGGGTGAGG + Intergenic
991919562 5:71642236-71642258 CTGGTGGTGGGAGTTGGGGGTGG + Intronic
992506871 5:77395727-77395749 CTGGTGAGGGGGTGGGGGTGGGG - Intronic
993139684 5:84016029-84016051 TGGGTGGTGGGAGGAGGGAGAGG - Intronic
993691959 5:91012861-91012883 GTGGAGGTGGGAGGAGGGAGAGG - Intronic
993881202 5:93363431-93363453 GTGGGGATGGGAGAAGGGAGGGG + Intergenic
994631964 5:102297290-102297312 GTGGTGATGGGGGTGGGGTGGGG - Intergenic
995003559 5:107163784-107163806 CTGTTGAGGGGTGGGGGGTGAGG + Intergenic
995946116 5:117648365-117648387 CTGGTGCCTGGAGGTGGGTGGGG - Intergenic
996076042 5:119195571-119195593 CTGGTGGTGGGGGGAGAATGGGG + Intronic
996398059 5:123032929-123032951 TTGGAGATGGGAGGAGGTAGAGG + Intronic
996523395 5:124451501-124451523 GTGGAGATGGAAGGAGGGGGAGG + Intergenic
996581323 5:125035201-125035223 AGTGGGATGGGAGGAGGGTGAGG - Intergenic
997001303 5:129765457-129765479 CTGGTGATCACAGGAGGATGAGG - Exonic
997286690 5:132684642-132684664 CTGTGGGTGGGAGGCGGGTGTGG + Intergenic
997381214 5:133439842-133439864 CAGGTGTGGGGAAGAGGGTGGGG - Intronic
997457038 5:134025264-134025286 ATGGGGTTGGGAGGAGGTTGTGG + Intergenic
997618946 5:135272449-135272471 CTGGGGATGGGAGCATGGTGGGG + Intronic
997836697 5:137200170-137200192 CTGGTGGAGGGTGGAGGGGGTGG - Intronic
997887523 5:137643879-137643901 CTGGGGAAGGGAGGAGGGAGGGG - Intronic
997999695 5:138615050-138615072 AAGGTGATGGGAAGAGGTTGAGG + Intronic
998007999 5:138670164-138670186 CTGGTCATGAAAGGAGGATGAGG - Intronic
998136714 5:139677925-139677947 CTGGAGCTGGGAGGAGGGAGGGG + Intronic
998564715 5:143206867-143206889 CTGGTGATAGCACGTGGGTGTGG + Intronic
998578218 5:143340965-143340987 CTGAGGGTGGGAGGAGGGAGAGG - Intronic
998696317 5:144643928-144643950 CTGGTGAGGGGTGGGGGGTGAGG - Intergenic
998913659 5:146991415-146991437 CTAGGGATGGGAGGCGGGAGAGG + Intronic
999124631 5:149238199-149238221 CTGGAGATGGCAGCAGGGTTGGG + Intronic
999369401 5:151044763-151044785 CTGGGGGTGTGAGGAGGGGGAGG + Intronic
999416646 5:151403468-151403490 TTGGTGCTGGGAGCAGGGGGAGG - Intergenic
999481754 5:151954794-151954816 CTGCTGATGGGGTGAGGGGGTGG + Intergenic
999768454 5:154757066-154757088 CTGGGGGTGGCAGGAGGGTGCGG + Intronic
1000224692 5:159249343-159249365 CTGCTGATTGTGGGAGGGTGGGG + Intergenic
1000510138 5:162170723-162170745 GTGGGGTTGGGAGGAGGGAGAGG + Intergenic
1001014184 5:168125856-168125878 CAGATGATGGGAGGAGGCAGGGG + Intronic
1001487017 5:172127199-172127221 CTGCTTTTGGGAGCAGGGTGTGG - Intronic
1001503477 5:172257126-172257148 CAGAGGATGGGAGGAGGGTGAGG - Intronic
1001535635 5:172496009-172496031 CTGGTGAAGGTGGGAGGGTGAGG - Intergenic
1001640456 5:173240262-173240284 CTGGGGAGGGGTGGGGGGTGAGG - Intergenic
1001648151 5:173297370-173297392 CTGGTGAGGGGAGGGGAGGGAGG - Intergenic
1001790020 5:174448135-174448157 CAGGAGATGGGAGGAGGAGGTGG - Intergenic
1002190746 5:177476196-177476218 GGGGTGGAGGGAGGAGGGTGGGG - Intergenic
1002341009 5:178516532-178516554 CTGGTGGTGGCAGGGGGCTGGGG - Intronic
1002381353 5:178832010-178832032 CCTGTGATGGGAGCAGGTTGGGG - Intergenic
1002399249 5:178982042-178982064 CTGGTGTGGGCAGGAGGGAGGGG + Intronic
1003135720 6:3433423-3433445 GGAGTGATGGGAGGAGTGTGGGG - Intronic
1003377452 6:5593026-5593048 GCAGAGATGGGAGGAGGGTGAGG - Intronic
1003545112 6:7052158-7052180 CGGGTGATGCGTGGAGGGGGTGG + Intergenic
1003686454 6:8308848-8308870 CTGTTGCAGGGTGGAGGGTGAGG - Intergenic
1003735073 6:8869071-8869093 CTGGTGAGGGGTGCAGGGTGTGG - Intergenic
1003873540 6:10419094-10419116 CTTGAGGTGGGAGGGGGGTGGGG + Intronic
1003915015 6:10778666-10778688 CTGGAGAGGGGAGGAGGGGCAGG + Intronic
1003982206 6:11400617-11400639 CTGGGAAGGGTAGGAGGGTGAGG + Intergenic
1004076691 6:12350445-12350467 CTGCTTGTGGGAGGAGGGTGAGG - Intergenic
1004172045 6:13302736-13302758 CTGGTGAGGGGTGTGGGGTGTGG - Intronic
1005504550 6:26458315-26458337 GAAGTGAAGGGAGGAGGGTGTGG + Intronic
1005518620 6:26578279-26578301 AGGATGATGGGAGGAGGATGAGG - Intergenic
1005932133 6:30491654-30491676 GTGGGGAAGGGAGAAGGGTGGGG + Intronic
1006143148 6:31943120-31943142 TTGGTGTGGGGAGGATGGTGAGG + Intronic
1006173438 6:32108347-32108369 CTGGTGGTGGGGGGCGGGGGCGG + Intronic
1006206066 6:32344267-32344289 CTGTTGTGGGGTGGAGGGTGGGG - Intronic
1006265251 6:32916252-32916274 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1006318001 6:33301865-33301887 CAGATGATGGGAGAAGGATGAGG + Intronic
1006319610 6:33312864-33312886 CAGGTGATGCGAGGTGGGAGGGG - Intronic
1006568827 6:34983374-34983396 CTGGAGATGAGAGGTGGCTGGGG - Exonic
1006734183 6:36260828-36260850 CTGGGGCAGGGAGGAGGGTGCGG + Intronic
1007055763 6:38882565-38882587 TTGGGGGTGGGAGAAGGGTGAGG + Intronic
1007089527 6:39173476-39173498 CTGGAGGTGGGAGGATGGTCAGG + Intergenic
1007100055 6:39239843-39239865 GTGGGGAAGGGAGGAGGATGAGG + Intergenic
1007228374 6:40330458-40330480 CTGGGGGTGGGAGGTGGGGGCGG + Intergenic
1007295015 6:40815036-40815058 CTCCTGAAGGGAGGACGGTGAGG - Intergenic
1007320813 6:41027865-41027887 GTGGTTAGGGGAGGTGGGTGTGG - Exonic
1007323126 6:41041341-41041363 GTGGGGCTGGGAGGAGGGTGGGG - Intronic
1007466719 6:42057445-42057467 CTGGGGATGTGCGGCGGGTGGGG - Exonic
1007513793 6:42395272-42395294 TGGGTGTTGGGAGGTGGGTGGGG - Intronic
1007656907 6:43455931-43455953 CTGGTGACAGGCGGAGGGCGGGG - Intronic
1007691532 6:43704834-43704856 CTGGTGAGGGGAGAAGGGGAGGG - Intergenic
1007717946 6:43868150-43868172 CTGAAGATGGGAGGAGAGAGAGG - Intergenic
1007935961 6:45732207-45732229 ATGGTGATGTGAGGATGGCGAGG - Intergenic
1007951434 6:45876051-45876073 CTGGTGAGCAGTGGAGGGTGGGG + Intergenic
1008033662 6:46723982-46724004 GTGGGGATGGAAGGTGGGTGTGG - Intronic
1008462633 6:51793501-51793523 CAGGTGGTGGGAGGAGGAAGAGG - Intronic
1008540039 6:52538396-52538418 CGGGGGATGGGAGGATGGAGGGG + Intronic
1008637403 6:53424562-53424584 CTGGTGAGGGGGGGAGGAGGTGG + Intergenic
1009871300 6:69454996-69455018 TTGTGGGTGGGAGGAGGGTGAGG + Intergenic
1009916203 6:70000010-70000032 CTGTTGAGGGATGGAGGGTGAGG - Intronic
1009946533 6:70347427-70347449 CTGGTGAAGAGTTGAGGGTGGGG + Intergenic
1010168196 6:72941625-72941647 GTGGGGAAGGGAGGAGGGAGGGG - Intronic
1010662783 6:78590287-78590309 CTGTTGGGGGGTGGAGGGTGAGG - Intergenic
1010882148 6:81190742-81190764 GGGATGATGGGAGGAGGGTGAGG + Intergenic
1012084684 6:94809198-94809220 CTGGTGGTGGGAAGAGGATTAGG + Intergenic
1012546361 6:100424057-100424079 CGGGGGGTGGGAGGGGGGTGGGG - Intronic
1012698695 6:102423405-102423427 CAGAGGATGGGAGGAGAGTGAGG + Intergenic
1013113190 6:107080437-107080459 ATGGTGACTGGAGTAGGGTGGGG - Intronic
1013446689 6:110236022-110236044 TGGGGGATGGGAGGAGGGAGAGG - Intronic
1013603161 6:111724201-111724223 CTGCTTATGGGAGCAGGGTGCGG - Intronic
1014638445 6:123878828-123878850 GTGGTGCAGGGAGGAGGGGGAGG - Intronic
1015181986 6:130370394-130370416 CTGGTGCTGGGATGAGGAGGAGG + Intronic
1015374372 6:132492917-132492939 CTGGGCATGGGAGGAGAGTGGGG - Intronic
1015395153 6:132725598-132725620 GGGATGGTGGGAGGAGGGTGAGG - Intronic
1015526896 6:134182586-134182608 CTTGTGATGTGCGTAGGGTGGGG - Intronic
1015582542 6:134741571-134741593 GTAGTGATGGGACGAGGGTGAGG + Intergenic
1015900401 6:138059268-138059290 GTAATGTTGGGAGGAGGGTGAGG + Intergenic
1016125821 6:140401878-140401900 CTAGTAATGGGAGGAGGGTTAGG - Intergenic
1016702333 6:147067614-147067636 CTGGTGATGGGGAGTGGGTCAGG + Intergenic
1016904142 6:149132334-149132356 TTGGTTATGGGAGGGGGGAGTGG - Intergenic
1017882919 6:158573903-158573925 ATGGGGAGGGGAGGAGAGTGGGG + Intronic
1017991397 6:159492538-159492560 CAGGTGATGGGGGGAGACTGGGG - Intergenic
1018027603 6:159818159-159818181 CTGGCAGTGGGAGGAGGCTGTGG + Intronic
1018325566 6:162664044-162664066 CTGTTGCAGGGTGGAGGGTGAGG - Intronic
1018443807 6:163836596-163836618 CAGGTGAATGGAGGAGGCTGAGG + Intergenic
1018856082 6:167676406-167676428 GTGGTGTTGGGAGGAGACTGTGG - Intergenic
1018902383 6:168058122-168058144 CTGGGCACGGGAGGAGGGAGGGG - Intronic
1018903524 6:168062827-168062849 GTGGGGAAGGGAGGAGGGGGTGG + Intronic
1018949383 6:168369267-168369289 ATGGTGTGGGGAGCAGGGTGGGG - Intergenic
1019127130 6:169848217-169848239 CAGGTGATGGGCAGAGGGTCAGG - Intergenic
1019278102 7:186717-186739 GGGGTGCTGGGAGGAGGCTGGGG - Intergenic
1019335697 7:481571-481593 GTGGGGAGGGGAGGAGTGTGGGG - Intergenic
1019335720 7:481625-481647 TTGGGGAGGGGAGGAGGGTGGGG - Intergenic
1019335729 7:481642-481664 GTGGGGAGGGGAGGAGGTTGGGG - Intergenic
1019591680 7:1838898-1838920 CTGGGGCGGGGAGGAGGCTGGGG + Intronic
1019690884 7:2410982-2411004 ATGGTGATTGGGGCAGGGTGGGG + Intronic
1020770344 7:12384334-12384356 CTGGGGTTGAGAGGAGGGAGGGG + Intronic
1021148265 7:17116854-17116876 CTGTTGAGGGGTGGAGGGTGAGG - Intergenic
1021240062 7:18189336-18189358 CTGTTGAGGGGTGGGGGGTGAGG + Intronic
1021240455 7:18194467-18194489 CTGGAGATGGGACAACGGTGAGG - Intronic
1021277854 7:18677135-18677157 CTGGGGCTGGGAGGAGAGTGAGG - Intronic
1021496089 7:21276238-21276260 CTGGGGAGGGGAGGAGGCTGGGG - Intergenic
1021677581 7:23097088-23097110 CAGGTGCTGGGAGCAGGGAGAGG - Intergenic
1022043141 7:26599794-26599816 CTGGGGAGGGGAGGTGTGTGAGG + Intergenic
1022634096 7:32115462-32115484 CTGTTGAGGGGAGGGGAGTGAGG + Intronic
1022680619 7:32542112-32542134 CTGGAGATGGGAGCAGGGACTGG + Intronic
1022704778 7:32792131-32792153 CTGTTGAGGTGAGGAGAGTGGGG + Intergenic
1022910113 7:34892734-34892756 CTGTTGAGGTGAGGAGAGTGGGG + Intergenic
1023630276 7:42156814-42156836 CTGGTGATGGGAGGAGGGTGTGG - Intronic
1024098205 7:46003258-46003280 CTAGTGAAGTGAGCAGGGTGTGG - Intergenic
1024119671 7:46224012-46224034 CTGTTGAGGGGTGGGGGGTGAGG + Intergenic
1024135430 7:46402513-46402535 GTGGAGATGGGAGGAGGGAGAGG + Intergenic
1024292107 7:47812255-47812277 CTGCTGCAGGGAAGAGGGTGGGG - Intronic
1024627532 7:51220776-51220798 CGGAAGGTGGGAGGAGGGTGAGG - Intronic
1024891543 7:54210162-54210184 CTGTGGCTGGGAGGTGGGTGAGG - Intergenic
1024923147 7:54582298-54582320 CAAGTGTTGGGGGGAGGGTGGGG + Intergenic
1024924964 7:54602640-54602662 ATGGTGAGGGGTGGAGAGTGAGG + Intergenic
1025206427 7:56995880-56995902 CGGGTGACAGGAGGAGGGAGAGG + Intergenic
1025828753 7:65032399-65032421 GGGAGGATGGGAGGAGGGTGAGG + Intergenic
1025916275 7:65868808-65868830 GGGAGGATGGGAGGAGGGTGAGG + Intergenic
1026029030 7:66773319-66773341 GTGGTGAGGGGAGGAAGCTGAGG - Intronic
1026090226 7:67293429-67293451 AAGGTGTTGGCAGGAGGGTGGGG + Intergenic
1026576225 7:71573814-71573836 CAGAGGGTGGGAGGAGGGTGAGG - Intronic
1027119820 7:75508744-75508766 AAGGTGTTGGCAGGAGGGTGGGG + Intergenic
1027226578 7:76247549-76247571 CTGGTGGGTGGAGGAGGGTACGG + Intronic
1027242606 7:76342344-76342366 CTGGTTTGGGGAGGAAGGTGTGG - Intronic
1027269773 7:76513061-76513083 CTGGGGATGGGAGGTGGTGGGGG - Intronic
1027272008 7:76526863-76526885 AAGGTGTTGGCAGGAGGGTGGGG - Intergenic
1027320484 7:77006956-77006978 CTGGGGATGGGAGGTGGTGGGGG - Intergenic
1027389799 7:77693479-77693501 TTGGGGATGGGAGGAGAATGGGG + Intergenic
1027629401 7:80583868-80583890 CTGGTCATGGGAGGGGGGAAAGG + Intronic
1028159962 7:87474886-87474908 CTGGCGATGAGAGGAGGGGGAGG + Intronic
1028162285 7:87499141-87499163 CTAGCGATGGGAGGAGGGGGAGG - Intergenic
1028480120 7:91295110-91295132 GTGGTGAGGGGGAGAGGGTGGGG + Intergenic
1028758378 7:94464711-94464733 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1029116165 7:98238325-98238347 GGGGGGGTGGGAGGAGGGTGTGG + Intronic
1029164208 7:98575152-98575174 CAGGGGGTGGGAGGAGGGAGAGG - Intergenic
1029339784 7:99933496-99933518 TTGTTGATGAGAGGAGGATGTGG - Intergenic
1029433636 7:100548746-100548768 CTGTTCATGGGAGGAGGAGGAGG - Intronic
1029578300 7:101418784-101418806 ATGGGGATGGGAGGAGGAGGTGG + Intronic
1029607158 7:101606022-101606044 CTGCTGATCGCAGAAGGGTGGGG - Intergenic
1029707618 7:102284070-102284092 CTGGAGATGAGAAGAGGGGGAGG - Intergenic
1029808725 7:103023978-103024000 GTGGAGGTGGGAGGATGGTGAGG + Intronic
1030379918 7:108800592-108800614 GTGGAGAAGGGAGGAGGGGGAGG - Intergenic
1030679177 7:112416159-112416181 ATGAGGATGGGAGAAGGGTGAGG + Intergenic
1031036923 7:116797790-116797812 CTGATGATGTAATGAGGGTGGGG - Intronic
1032366211 7:131302393-131302415 GTGGTGATGGGAGAAAAGTGTGG + Intronic
1032434288 7:131887561-131887583 CTTGTGTTAGGAGCAGGGTGAGG - Intergenic
1032448420 7:132004387-132004409 CTGGGGTTAGGAGGAGGGAGGGG + Intergenic
1033401281 7:141027412-141027434 CTGGCTATGGGAGCTGGGTGAGG - Intergenic
1034164709 7:149016632-149016654 CTGGTGTGTGGAGGAGGCTGAGG - Intronic
1034534452 7:151718264-151718286 ATGGTGGTGGGTGGAGGGGGGGG + Intronic
1034965136 7:155386184-155386206 CTGGAGCTGGGAGGAGGCTGGGG - Intronic
1035230558 7:157463544-157463566 AGGGGGATGGGATGAGGGTGAGG - Intergenic
1035313841 7:157986075-157986097 ATGGAGGTGGGAGGAGGGAGGGG + Intronic
1035472198 7:159117635-159117657 CTGAAGATGGAAGGAGGGTGTGG - Intronic
1035577334 8:716218-716240 CAGCTGATGGCAGGATGGTGGGG - Intronic
1035649285 8:1252996-1253018 CTGGTGCTGGGAGGCCTGTGGGG - Intergenic
1035724791 8:1817701-1817723 CTGGGGACGGCAGGAGGGAGGGG + Intergenic
1036044429 8:5123531-5123553 CTGTTGAGGGGTGGAGGGTGAGG - Intergenic
1036659760 8:10700376-10700398 CTGGTGATGGGGGGCGGGATAGG - Exonic
1036824122 8:11963159-11963181 CTGGAGATCGGAGCAGAGTGAGG + Intergenic
1036899986 8:12663233-12663255 GTGGGGAGGGGTGGAGGGTGGGG - Intergenic
1037599640 8:20383241-20383263 CTAGTGAAGGGAGGAGGATGGGG - Intergenic
1038019235 8:23539056-23539078 CTGGGGTTACGAGGAGGGTGGGG - Intronic
1038127453 8:24690616-24690638 AAGGTGATGGTAGGAAGGTGGGG + Intergenic
1038335014 8:26639012-26639034 CGGGTTATGGGAGAGGGGTGAGG - Intronic
1038436988 8:27543127-27543149 CTGGTTGTGGGAGGAGGGAGGGG + Intronic
1038971144 8:32636890-32636912 GTAGTGATGGGTGGAGGCTGGGG + Intronic
1039389196 8:37163367-37163389 CAGGGAAGGGGAGGAGGGTGGGG + Intergenic
1039464063 8:37770893-37770915 AAGGTGATGGGAGGAGGGAGCGG + Intronic
1039554476 8:38466891-38466913 GTGGTGGTGGGGGGGGGGTGGGG - Intronic
1039843029 8:41307222-41307244 CTGGTGTTGGGAGTGGAGTGAGG - Intronic
1039914543 8:41850063-41850085 CTGGTGCCGGCAGGAGGGTGAGG - Intronic
1039916740 8:41865707-41865729 CTGCTGGGGGGAGGAGGGAGAGG - Intronic
1040508147 8:48070064-48070086 CTAGAGGTGGGAGGAGGGAGAGG - Intergenic
1040530192 8:48260627-48260649 CTGGGGAAGGAAGGTGGGTGCGG - Intergenic
1040595205 8:48831857-48831879 CTGTTGGTGGGAGAAGGATGTGG + Intergenic
1040883927 8:52238859-52238881 TGGGGGGTGGGAGGAGGGTGAGG + Intronic
1040936401 8:52786269-52786291 CTGGTGAGGGGGTGAGTGTGGGG + Intergenic
1041140957 8:54818978-54819000 CTGGGGATGGGAAGAGGAGGGGG + Intergenic
1041544664 8:59029219-59029241 ATGGGGATGGGGGGTGGGTGGGG - Intronic
1041698583 8:60763078-60763100 CCAGTGAGGGGAGCAGGGTGTGG + Intronic
1041775590 8:61519516-61519538 CAGGTTATGGGATGAGGGTATGG - Intronic
1041788570 8:61664532-61664554 TGGATGATGGGAGAAGGGTGAGG + Intronic
1042182431 8:66105056-66105078 TTGGTGGTGGTGGGAGGGTGTGG - Intergenic
1042572940 8:70186369-70186391 CTGGTCAGGGGAGGAAAGTGAGG - Intronic
1042986513 8:74589781-74589803 CTGATGACTGGAGAAGGGTGTGG + Intergenic
1043064788 8:75555046-75555068 CAGGTGATGGGAGGCGTGAGAGG - Intronic
1043092360 8:75921752-75921774 CTGGTGGTGGGCGAAGGGGGGGG + Intergenic
1043638557 8:82418474-82418496 TTGGTTAGGGGAGGAGGGCGGGG + Intergenic
1043750390 8:83926773-83926795 CTGGTGCTGGGAGCAGGGAGAGG + Intergenic
1045014314 8:97986438-97986460 CTTGGGGTGGGAGGATGGTGAGG - Intronic
1045047016 8:98288878-98288900 GTTGTGATGGGAGGAGGGAAAGG - Intronic
1045554988 8:103207089-103207111 CTGGGGATGGGTGCAGGGTCAGG + Intronic
1046598250 8:116286735-116286757 CTGGTGAAGGGAGGTGGCTGAGG - Intergenic
1046774521 8:118150008-118150030 CTGGTGATGGGAAGGGAGGGGGG - Intergenic
1048049269 8:130802107-130802129 TTTGTGATTGGAGGAGGGTGAGG - Intronic
1048265150 8:132979128-132979150 GTGCTGAGGGGAGGAGGGGGTGG + Intronic
1048452099 8:134542441-134542463 AGGGTGGTGGGAGGAGGATGAGG - Intronic
1048640733 8:136357655-136357677 TGGGAGGTGGGAGGAGGGTGAGG - Intergenic
1048679677 8:136826022-136826044 TAGAAGATGGGAGGAGGGTGAGG + Intergenic
1048926854 8:139279013-139279035 CTGTTGGGGGGTGGAGGGTGAGG + Intergenic
1049108434 8:140628026-140628048 CTGGTTTTGGGATAAGGGTGGGG - Intronic
1049217473 8:141414846-141414868 CTGGTGATATCAGGAGGGGGCGG - Intronic
1049365824 8:142236415-142236437 TTGGTGCAGGAAGGAGGGTGGGG - Intronic
1049427966 8:142545681-142545703 CCTGGGGTGGGAGGAGGGTGTGG - Intergenic
1049614504 8:143570228-143570250 CTGGCCAGGTGAGGAGGGTGAGG - Exonic
1049624876 8:143615418-143615440 CTGGTCTTGGGAGAAGGGAGAGG + Intronic
1049657459 8:143805100-143805122 CTGGTGATGCGGTGAGGCTGGGG - Exonic
1049659345 8:143812754-143812776 CTGGCCCTGGGAGGAGCGTGGGG - Intronic
1049683174 8:143928866-143928888 CTGGTGATGAGATTCGGGTGTGG - Intronic
1049773708 8:144395232-144395254 CTGAGGATGGGAGTATGGTGTGG + Intronic
1049796720 8:144500389-144500411 CTGGTGAGGGCTGGGGGGTGAGG + Exonic
1050010124 9:1177441-1177463 CTGGGGAAGGGAGGAGGGTGTGG + Intergenic
1050865003 9:10487696-10487718 CTGTTGGGGGGTGGAGGGTGAGG + Intronic
1051129995 9:13850038-13850060 TGGAGGATGGGAGGAGGGTGAGG + Intergenic
1051524044 9:18022444-18022466 CTGGCTATGGGAAGTGGGTGAGG + Intergenic
1051825326 9:21212331-21212353 CTGGTGATGTGAGGGGTGGGTGG - Intronic
1053129889 9:35608935-35608957 CTGGTGATGGGGGCAGGAAGAGG - Exonic
1053275606 9:36781021-36781043 CAGGTGGTGGGTGGAGGGGGAGG + Intergenic
1053688627 9:40568182-40568204 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1053790573 9:41683505-41683527 CAGATGATGTGAGGTGGGTGGGG - Intergenic
1054154587 9:61631296-61631318 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1054178918 9:61895204-61895226 CAGATGATGTGAGGTGGGTGGGG - Intergenic
1054275406 9:63062875-63062897 CTGAGGATGGAAGAAGGGTGCGG + Intergenic
1054299867 9:63369093-63369115 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1054399427 9:64702056-64702078 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1054433005 9:65186321-65186343 CTGAGGATGGAAGAAGGGTGCGG - Intergenic
1054474361 9:65562372-65562394 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1054497378 9:65835354-65835376 CTGAGGATGGAAGAAGGGTGCGG + Intergenic
1054658619 9:67685627-67685649 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1054810539 9:69430500-69430522 CTGGTGGTGGGAGCAGGGAAGGG + Exonic
1055409688 9:76015848-76015870 CTGGAGAGGTGAGGAAGGTGTGG - Intronic
1055662375 9:78517893-78517915 CAGGTAATTGAAGGAGGGTGAGG + Intergenic
1055930163 9:81551947-81551969 CCAGTAATGGGAGGGGGGTGAGG + Intergenic
1055989682 9:82092130-82092152 CTGGTGAGGGTAGAAGGTTGGGG + Intergenic
1056464190 9:86837906-86837928 CTGGTAATTGGAGGAGTTTGTGG + Intergenic
1056578406 9:87872806-87872828 CTGGGGCTGGGAGGAAGGTGGGG - Intergenic
1056849330 9:90068971-90068993 CTGGGGTGGGGAGGAGGGTTGGG - Intergenic
1057029442 9:91763177-91763199 CTGAAGGTAGGAGGAGGGTGAGG + Intronic
1057226416 9:93295694-93295716 ATGGTGACGGGAGGATGGAGAGG - Intronic
1057226463 9:93295861-93295883 ATGGAGAGGGGAGGAAGGTGAGG - Intronic
1057226491 9:93295973-93295995 AAGGTGAAGGGAGGATGGTGAGG - Intronic
1057226503 9:93296015-93296037 ATGGAGAGGGGAGGAAGGTGAGG - Intronic
1057226537 9:93296109-93296131 ATGGAGAGGGGAGGAAGGTGAGG - Intronic
1057226546 9:93296137-93296159 GTGGTGAGGGGAGGAAGGAGAGG - Intronic
1057226551 9:93296151-93296173 ATGGTGAGGGGAGGGTGGTGAGG - Intronic
1057226557 9:93296165-93296187 GTGGTGAGGGGAGGATGGTGAGG - Intronic
1057226562 9:93296179-93296201 ATGGTGAGGGGAGGGTGGTGAGG - Intronic
1057226582 9:93296235-93296257 ATGGAGAGGGGAGGAAGGTGAGG - Intronic
1057226596 9:93296275-93296297 AAGGTGAGGGGAGGAAGGTGAGG - Intronic
1057226611 9:93296316-93296338 GTGGTGAGGGGAGGAAGGAGAGG - Intronic
1057226626 9:93296358-93296380 AAGGTGAGGGGAGGATGGTGAGG - Intronic
1057226732 9:93296673-93296695 ATGGAGAGGGGAGGAGGATGAGG - Intronic
1057547976 9:96032189-96032211 CTGATGAAGGGAGGTGTGTGGGG - Intergenic
1057577385 9:96254280-96254302 CTGCTGTTGGCAGGAGGATGAGG - Intronic
1057747932 9:97766566-97766588 TTGGTGATGGGAACAGAGTGTGG + Intergenic
1059203037 9:112436124-112436146 CTGGATATGGTGGGAGGGTGAGG + Intronic
1059450878 9:114370850-114370872 GTGGGGATGGGGGGAGGGGGAGG - Intronic
1059505881 9:114799595-114799617 CTGGGGATGTGAAGTGGGTGGGG - Intronic
1059679877 9:116575925-116575947 CTGGTGATGGGGAGAGGAAGAGG + Intronic
1059961606 9:119570322-119570344 CTGATGCTGGGACTAGGGTGGGG + Intergenic
1060026666 9:120177750-120177772 CTGTTGTGGGGTGGAGGGTGAGG - Intergenic
1060034995 9:120247589-120247611 CTGGAGTTGGGAGGAGGCTGAGG + Intergenic
1060206045 9:121683391-121683413 AGGTTGATGGGAGGGGGGTGGGG - Intronic
1061046674 9:128169032-128169054 CAGGTGCTGGGGGGAGGGTGTGG - Exonic
1061415050 9:130443056-130443078 CTGTTGGTGGCAGGACGGTGGGG + Intergenic
1061571240 9:131478617-131478639 CAGGTGAGGGGCGGAGGGTGGGG + Exonic
1062031775 9:134365089-134365111 CTGGTGCTGGCAGGAGGGGGCGG + Intronic
1062181390 9:135193024-135193046 CTGGTGCTGGGAGGAAGACGTGG - Intergenic
1062560159 9:137138067-137138089 CTGGAGCTGAGAGGAGGGGGAGG - Intergenic
1062581553 9:137231219-137231241 CTGGTGATGGGGAGCAGGTGGGG - Intronic
1062682157 9:137787853-137787875 TTGGGGATAGGAGGTGGGTGGGG + Intronic
1185575459 X:1168906-1168928 ATGGGGAGGGGAGGAGGGAGAGG + Intergenic
1186126967 X:6425182-6425204 CTGGTGATGGGAAGAAGATCAGG + Intergenic
1186301340 X:8202952-8202974 CTGGTGTTGGGAAGAGGTAGTGG - Intergenic
1186407109 X:9313751-9313773 GTGGTGATGGGAAGTGGATGGGG + Intergenic
1186457970 X:9725613-9725635 CTGGTGATGAGAGCAAGGTTTGG + Exonic
1186616002 X:11188722-11188744 CTCGGGCTAGGAGGAGGGTGAGG - Exonic
1186662542 X:11683600-11683622 TTGAGGGTGGGAGGAGGGTGAGG + Intergenic
1186797268 X:13058942-13058964 CTGATGCTGGGAGATGGGTGAGG + Intergenic
1186912624 X:14185197-14185219 CAGGAGCTGGGAGGAGGGAGAGG + Intergenic
1187240434 X:17508235-17508257 TTGGTGGTGGGAGGGGGCTGGGG - Intronic
1188057947 X:25563404-25563426 ATGGTGATGGGAGGAGCAAGGGG + Intergenic
1188123765 X:26342564-26342586 GTGGTGGGGGGAGGAGGGTGAGG - Intergenic
1188295923 X:28448127-28448149 TGGAAGATGGGAGGAGGGTGAGG + Intergenic
1188717839 X:33482435-33482457 TAGATGTTGGGAGGAGGGTGAGG + Intergenic
1188806426 X:34596276-34596298 TAGGGGATGGGAGGAGGGAGAGG - Intergenic
1188816673 X:34723525-34723547 TTGAGGATGGGAGGAGGATGAGG - Intergenic
1189219484 X:39358924-39358946 CTGGTGTTTAGAGGAAGGTGAGG - Intergenic
1189280903 X:39819640-39819662 ATGGTCAGGGGCGGAGGGTGGGG + Intergenic
1189446626 X:41086165-41086187 TGGGTGAGGGGAGGAGGGCGAGG + Intronic
1190054372 X:47173353-47173375 CTGGAGCTGTGAGGAGAGTGTGG - Intronic
1190109343 X:47579853-47579875 GGGGTGGTGGGGGGAGGGTGGGG - Intronic
1190377970 X:49808583-49808605 TGGAAGATGGGAGGAGGGTGAGG - Intergenic
1190399016 X:50013209-50013231 CTGCACATGGGAGGGGGGTGGGG - Intronic
1190586026 X:51943221-51943243 TCGGGGATGGGAGGAGGGAGAGG + Intergenic
1191096925 X:56682843-56682865 TTGAAGTTGGGAGGAGGGTGAGG + Intergenic
1191579835 X:62748194-62748216 CTGTTGATGGGTGGGGGGAGGGG + Intergenic
1191671438 X:63752125-63752147 AGGGTGATGGGAGGAGGGGAAGG - Intronic
1191682905 X:63859446-63859468 CTGGAGATGGGAAGAAAGTGGGG - Intergenic
1191685949 X:63891094-63891116 GTGGCAGTGGGAGGAGGGTGAGG + Intergenic
1191891105 X:65942298-65942320 TGGATGGTGGGAGGAGGGTGAGG - Intergenic
1191911866 X:66160260-66160282 CTGGTGGTGGTGGGAGGTTGGGG + Intergenic
1192203970 X:69084081-69084103 CTGGTGAGTGGAGGTGGGTGAGG - Intergenic
1192272524 X:69595552-69595574 CTGGTGGTGGGAGGGGGATGGGG + Intergenic
1192464906 X:71347884-71347906 GTGGCGATGGGGGGAGGGGGAGG - Intergenic
1192799201 X:74449866-74449888 TTGTTGATGGGAGAAGGGTTAGG - Intronic
1192902952 X:75519831-75519853 CTGATGATGGCAGGAGGGACTGG + Intronic
1193638706 X:83985028-83985050 CTGGTGGTGGCAGCAGGGAGGGG - Intergenic
1193770224 X:85579389-85579411 AAGATGGTGGGAGGAGGGTGAGG + Intergenic
1194019226 X:88666410-88666432 CTGGTGAGGGCAGGGTGGTGAGG - Intergenic
1194251394 X:91579727-91579749 TGGGTGGTGGGAGGAGGGTGAGG - Intergenic
1194855389 X:98921475-98921497 GTGGTGATGGGGGGGTGGTGGGG - Intergenic
1194976699 X:100403409-100403431 CTAGGGCAGGGAGGAGGGTGTGG - Intronic
1195469712 X:105218773-105218795 GTGGTGACTGGAGGAGGGGGAGG - Intronic
1195732858 X:107982838-107982860 GGGGTGATGGGAGGAGTGTGGGG - Intergenic
1196166085 X:112536712-112536734 GTCGTGCTGGGATGAGGGTGGGG - Intergenic
1196245167 X:113391610-113391632 CTGGTGAAAAGTGGAGGGTGGGG + Intergenic
1196486007 X:116207849-116207871 GGGAGGATGGGAGGAGGGTGAGG + Intergenic
1196579936 X:117367058-117367080 TGGAGGATGGGAGGAGGGTGAGG - Intergenic
1196704538 X:118705676-118705698 GTGGGGAAGGGAGGAGAGTGAGG - Intergenic
1197306059 X:124843481-124843503 CTGGTGAAAGGAGTAGGGAGGGG - Intronic
1197801754 X:130356930-130356952 CTGGAGATGGGTTGAGGGAGTGG - Intronic
1198018966 X:132639781-132639803 CAGTGGATGGGAGGAGGTTGGGG + Intronic
1198380266 X:136077066-136077088 ATGCAGATGTGAGGAGGGTGAGG - Intergenic
1198712383 X:139519549-139519571 CTGCTGTTGGGGGGCGGGTGGGG - Intergenic
1199095147 X:143729314-143729336 CTGTTGAGGGGTGGAGGGTGAGG + Intergenic
1199257754 X:145735994-145736016 CAGAGGGTGGGAGGAGGGTGAGG + Intergenic
1199649563 X:149939110-149939132 CTGGTGAGAGGAGGAAGGTGGGG + Intergenic
1200070106 X:153524996-153525018 CCGCAGATGGGAGGCGGGTGTGG + Intronic
1200570335 Y:4820958-4820980 TGGGTGGTGGGAGGAGGGTGAGG - Intergenic
1201238825 Y:11938180-11938202 CTGTTGAGGGGTGGAGGGAGGGG + Intergenic
1201479010 Y:14417109-14417131 GTGAGGATGGGAGGAGGGAGAGG + Intergenic
1202348945 Y:23966198-23966220 GGGGTGAGGGGAGGAGGGGGAGG + Intergenic
1202521830 Y:25703906-25703928 GGGGTGAGGGGAGGAGGGGGAGG - Intergenic
1202628401 Y:56883708-56883730 CTGGTGGATGGAGAAGGGTGGGG + Intergenic