ID: 1023632219

View in Genome Browser
Species Human (GRCh38)
Location 7:42176202-42176224
Sequence TTGGGTCAGCACCAGCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023632219_1023632224 12 Left 1023632219 7:42176202-42176224 CCCATATGCTGGTGCTGACCCAA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1023632224 7:42176237-42176259 AGATCCACCAAGATGCCAGAAGG No data
1023632219_1023632227 19 Left 1023632219 7:42176202-42176224 CCCATATGCTGGTGCTGACCCAA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1023632227 7:42176244-42176266 CCAAGATGCCAGAAGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023632219 Original CRISPR TTGGGTCAGCACCAGCATAT GGG (reversed) Intronic
909051497 1:70773749-70773771 TTGGGTCAGCTGCAGCTTGTTGG + Intergenic
918713699 1:187763418-187763440 TTTGGTCAGCAGTGGCATATTGG + Intergenic
919865567 1:201780319-201780341 ATGGCTCTGCACCAGTATATAGG - Intronic
921135043 1:212252448-212252470 CTGGGCCAGCAGCAGCATCTGGG + Intergenic
921782469 1:219182138-219182160 TTGAGTGAGCACCAGATTATGGG + Intronic
1062939112 10:1408813-1408835 TTGTGTCTGCACCAGCACACAGG + Intronic
1067377340 10:45740019-45740041 TTGGGGCAGTATCAGTATATTGG + Intronic
1067885045 10:50080704-50080726 TTGGGGCAGTATCAGTATATTGG + Intronic
1074606544 10:114975138-114975160 TCGGGTCAGCTCTAGCACATTGG - Exonic
1076701152 10:132273897-132273919 TGGGGTCAGCACACGCATAGTGG - Intronic
1086900991 11:92367221-92367243 GTGGATCAGCACCAGCTTGTAGG + Intronic
1088115783 11:106311228-106311250 TTGGGTAAGTACAAGGATATGGG + Intergenic
1091999722 12:5022290-5022312 TTGGGCCAGCAGCATCATTTGGG + Intergenic
1096379820 12:51146892-51146914 TAGATTCAGCACCTGCATATGGG + Intronic
1103699595 12:122842007-122842029 CTGGGTCAGCTCCAGCAGACAGG - Intronic
1106356212 13:28986119-28986141 TTGGGTCTGAAGCAGCATCTAGG + Intronic
1107671849 13:42754171-42754193 TGGGGTCAGCACCAGCAGTCTGG + Intergenic
1111148256 13:84214173-84214195 ATGGGTCAGCACCACCCTGTTGG + Intergenic
1114059021 14:19002081-19002103 TTGGGTCAACTGCAGCTTATTGG - Intergenic
1117419942 14:55534344-55534366 TTTGGTCATCATCAGCATTTGGG + Intergenic
1121239076 14:92415012-92415034 TTGGGTGTGCACCTGCAGATGGG + Intronic
1121396273 14:93625951-93625973 ATTGGTCAGCAACAGCACATGGG + Intronic
1202836285 14_GL000009v2_random:79621-79643 TTGGGTCAACCGCAGCTTATTGG - Intergenic
1126243432 15:46473214-46473236 TTGGCTCAGCATCAGCATTCTGG - Intergenic
1128719751 15:69939760-69939782 TTGGGGCAGCAGCAGCAGAGAGG + Intergenic
1131449146 15:92524832-92524854 ATGGGTCAGGACCAACATTTAGG - Intergenic
1140296371 16:73712980-73713002 GTGGGCCAGCTCCTGCATATGGG - Intergenic
1141586139 16:85034847-85034869 TAGGGGCAGCGCCAGCACATGGG + Intronic
1144200811 17:12940599-12940621 TTGGTTGATCACAAGCATATGGG - Intronic
1146401745 17:32505063-32505085 TTGGGTCTGCCCCAGCACAGGGG + Intronic
1147793862 17:43029015-43029037 TTGGGCCAGAACCAGGATATGGG - Exonic
1156828277 18:41459592-41459614 AGGAGTCAGCACCAGCTTATTGG + Intergenic
1158076620 18:53537307-53537329 TAGTGTCAGCAGCAGAATATGGG + Intergenic
1166274525 19:41743277-41743299 TTGGGTCAGAACCATCCTAGTGG - Intronic
1202636354 1_KI270706v1_random:47744-47766 TTGGGTCAACCGCAGCTTATTGG + Intergenic
925733153 2:6937268-6937290 TTTTCTCAGCACCAGCAAATGGG - Intronic
925881943 2:8360055-8360077 TGGCGTCAGCACCTGCAAATCGG + Intergenic
926715580 2:15921401-15921423 TTGGGGCAGGACCAGCCTTTGGG + Intergenic
927680162 2:25133620-25133642 CTGGGTCAGCCACAGCAAATGGG + Intronic
929776883 2:44935541-44935563 CAGGGTCAGCACCAGCAGCTCGG + Intergenic
938282166 2:130072151-130072173 TTGGGTCAACTGCAGCTTATTGG + Intergenic
938332793 2:130460723-130460745 TTGGGTCAACTGCAGCTTATTGG + Exonic
938357015 2:130659948-130659970 TTGGGTCAACTGCAGCTTATTGG - Intergenic
938433451 2:131266754-131266776 TTGGGTCAACTGCAGCTTATTGG - Intronic
938477490 2:131629340-131629362 TTGGGTCAACTGCAGCTTATTGG - Intergenic
941344303 2:164348451-164348473 TTGGGTCAACTGCAGCTTATTGG + Intergenic
941622344 2:167792488-167792510 ATGGGTCAGCAGTAGCATACAGG + Intergenic
944176970 2:196841291-196841313 TTGGGTCAGCACATTTATATAGG - Exonic
944517553 2:200527257-200527279 TTGTGTCAGAACCAGCTTATTGG + Intronic
946359312 2:219209565-219209587 TCGGGGCAGCTCCAGCATAAGGG - Exonic
947927591 2:233935377-233935399 GTGGGTCAGCACCAGGATGCAGG - Intronic
1171882485 20:30628672-30628694 TTGGGTCAACTGCAGCTTATTGG + Intergenic
1174925073 20:54750419-54750441 GAGGGGCAGCACCAGCCTATTGG - Intergenic
1179819115 21:43926157-43926179 CTGGGTCAGCACCAGGGTACAGG + Intronic
1180364511 22:11926572-11926594 TTGGGTCAACCGCAGCTTATTGG - Intergenic
1180477505 22:15724697-15724719 TTGGGTCAACTGCAGCTTATTGG - Intergenic
1185100827 22:48840095-48840117 TTGGATCAGCTCCAGCAGATGGG + Intronic
951830067 3:26916669-26916691 TAAGGTCAGCACCAGCATCGTGG - Intergenic
959070420 3:101696688-101696710 TTCGGTCAGCACAAGTAAATAGG + Intergenic
960680487 3:120242755-120242777 TTGGGTCAGCCTCAGCATGGTGG - Intronic
961221987 3:125208285-125208307 TTGGGCCAACACCAGAATGTGGG - Intronic
965950931 3:174307552-174307574 GTGGGTCAGAATCTGCATATGGG + Intergenic
968725333 4:2245321-2245343 TTGGGTCAGCACAAGCCCAAAGG + Intergenic
970253049 4:14136801-14136823 TTGGGTAACCACCAGCATGCAGG + Intergenic
971163344 4:24156914-24156936 TTTGGTCAGCAACACCATTTGGG - Intergenic
973366154 4:49211115-49211137 TTGGGTCAACTGCAGCTTATTGG + Intergenic
973394443 4:49581321-49581343 TTGGGTCAACTGCAGCTTATTGG - Intergenic
973699175 4:53519945-53519967 TAGGGTGAGCACCAGCACATCGG - Intronic
976954650 4:90880467-90880489 TTGGGTCAACTGCAGCTTATTGG + Intronic
977331943 4:95647401-95647423 TTTGGTAAGCAGCAGCATCTAGG - Intergenic
980849835 4:138367573-138367595 GTGGGTAAGCTCCAACATATGGG - Intergenic
1202763671 4_GL000008v2_random:133611-133633 TTGGGTCAACCGCAGCTTATTGG + Intergenic
986362155 5:6989413-6989435 TTGTATCAGCACCGGTATATAGG + Intergenic
986719154 5:10547716-10547738 TTGGGTCAGCAGCAGCATGGTGG - Intergenic
987280090 5:16404939-16404961 TTGGGTGGGCACTAGCATTTGGG - Intergenic
989285551 5:39695057-39695079 TTTTGTTTGCACCAGCATATGGG + Intergenic
990323841 5:54655234-54655256 GTGGGTGAGCACCATCCTATTGG + Intergenic
990417211 5:55597939-55597961 TTGGGCCAGCCCCACCATCTGGG - Intergenic
990537758 5:56739786-56739808 TTGTTTGAGCACCAGCATCTAGG + Intergenic
996021372 5:118594398-118594420 TTGGGCCAGCCCCAGCAGATGGG + Intergenic
996732413 5:126728619-126728641 TTGGGTCAGAACCAGCACTACGG + Intergenic
997486621 5:134236377-134236399 TGGCCTCAGCACCAGCACATGGG - Intergenic
1013857475 6:114591495-114591517 CTGGGTGAGCACCAGCCTGTGGG + Intergenic
1016620382 6:146102589-146102611 ATGGGACAGCACCAGGAGATGGG - Intronic
1017162835 6:151381667-151381689 TTAGGTTAGCACCAGAGTATGGG - Intronic
1023632219 7:42176202-42176224 TTGGGTCAGCACCAGCATATGGG - Intronic
1034787655 7:153940203-153940225 CTAGGTCAGCACCAGCTTTTCGG - Intronic
1038996528 8:32929065-32929087 TTGGGTGAGCAAGAGCAGATGGG - Intergenic
1039432711 8:37537886-37537908 TAGGGTCACCATCAGAATATTGG + Intergenic
1048119392 8:131563124-131563146 ATGTGTCAGCAGCAGCACATGGG + Intergenic
1056888264 9:90465064-90465086 TTGGGGCAGTAGCAGCATATTGG + Intergenic
1057818753 9:98315313-98315335 CTGGATCAGCACCTGAATATGGG - Intronic
1058152701 9:101479781-101479803 TGGGGTCAGCTCCAGAATGTAGG + Intronic
1060664763 9:125426233-125426255 TTCGGTCAGAACGAGCATCTGGG - Intergenic
1203544424 Un_KI270743v1:118484-118506 TTGGGTCAACCGCAGCTTATTGG + Intergenic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185793379 X:2944703-2944725 CTGGGTGAGCACCTGTATATGGG - Intronic
1198737813 X:139806986-139807008 TTGTATCAGCACCAGGTTATTGG - Intronic