ID: 1023632731

View in Genome Browser
Species Human (GRCh38)
Location 7:42179908-42179930
Sequence GCCCATCAGACACTTCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023632731_1023632732 3 Left 1023632731 7:42179908-42179930 CCAAACAGAAGTGTCTGATGGGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1023632732 7:42179934-42179956 TGATACACAAGTGTGAAGTTTGG 0: 1
1: 0
2: 0
3: 9
4: 146
1023632731_1023632734 8 Left 1023632731 7:42179908-42179930 CCAAACAGAAGTGTCTGATGGGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1023632734 7:42179939-42179961 CACAAGTGTGAAGTTTGGATGGG No data
1023632731_1023632737 23 Left 1023632731 7:42179908-42179930 CCAAACAGAAGTGTCTGATGGGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1023632737 7:42179954-42179976 TGGATGGGAGAGAGCAGGGCTGG 0: 1
1: 0
2: 12
3: 79
4: 861
1023632731_1023632733 7 Left 1023632731 7:42179908-42179930 CCAAACAGAAGTGTCTGATGGGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1023632733 7:42179938-42179960 ACACAAGTGTGAAGTTTGGATGG No data
1023632731_1023632736 19 Left 1023632731 7:42179908-42179930 CCAAACAGAAGTGTCTGATGGGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1023632736 7:42179950-42179972 AGTTTGGATGGGAGAGAGCAGGG 0: 1
1: 0
2: 3
3: 40
4: 432
1023632731_1023632735 18 Left 1023632731 7:42179908-42179930 CCAAACAGAAGTGTCTGATGGGC 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1023632735 7:42179949-42179971 AAGTTTGGATGGGAGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023632731 Original CRISPR GCCCATCAGACACTTCTGTT TGG (reversed) Intronic
901226338 1:7614883-7614905 GCCCATCAGATACTGCTGGGGGG + Intronic
903390218 1:22958758-22958780 GTCCATCAGGCCCTGCTGTTCGG + Exonic
904830055 1:33300546-33300568 GCCCCTCAGACACTTCAGGAAGG + Exonic
911337188 1:96595269-96595291 GCCTCTGAAACACTTCTGTTTGG - Intergenic
917260638 1:173164245-173164267 GCCAATCAGAAACACCTGTTTGG - Intergenic
919425554 1:197426007-197426029 GCCCACTAGTCACTTCTGCTTGG + Intronic
919983487 1:202657285-202657307 GCCCTTGAGACTCTTCTGGTGGG - Intronic
920073615 1:203321268-203321290 GCAGGGCAGACACTTCTGTTCGG + Intergenic
920666206 1:207964301-207964323 GCCCTTCAGACAGTTATGCTTGG - Intergenic
1067858331 10:49817518-49817540 GCCCATCTTACATTTATGTTAGG + Intergenic
1070744328 10:78923765-78923787 GCCCATCAGACAGATTTATTAGG + Intergenic
1073191654 10:101655543-101655565 GCCCAGCTGACCCTTCTCTTAGG + Intronic
1074306184 10:112280764-112280786 ACCCATCAGACATTTCTGCTGGG + Intergenic
1076036250 10:127200966-127200988 GCCCATCACAGACTTAGGTTGGG - Intronic
1077249608 11:1555201-1555223 GCCCAAAAGCCACTTGTGTTTGG + Exonic
1078351232 11:10595379-10595401 TCCCACCTGACACTTTTGTTTGG + Intronic
1078448815 11:11425128-11425150 GCCCATCTGACACTGTTGTTGGG + Intronic
1079677287 11:23246045-23246067 GCCTATCAGGAACTCCTGTTTGG - Intergenic
1084600201 11:70141039-70141061 GCGCATCTGAGACGTCTGTTAGG - Intronic
1086203552 11:84232513-84232535 CCCCATCTGAAAATTCTGTTGGG - Intronic
1088355911 11:108943651-108943673 GTCCCTCAGACACATATGTTAGG - Intergenic
1092107712 12:5934577-5934599 GCCCATCCTACACTTTGGTTTGG + Intronic
1099636607 12:85221742-85221764 TATCTTCAGACACTTCTGTTAGG - Intronic
1101806092 12:108065218-108065240 GCCCATCTGACACTTTTATTGGG - Intergenic
1104169360 12:126265158-126265180 CCCCTACAGACATTTCTGTTTGG - Intergenic
1104222937 12:126803352-126803374 CCCCTACAGACATTTCTGTTTGG - Intergenic
1104650622 12:130529662-130529684 GCCCTTCAGACTCTTTTGCTGGG - Intronic
1113771797 13:112914593-112914615 TCCCATCAGACACCTCTGCAGGG - Intronic
1116005950 14:39290200-39290222 GCCCATCAGCCTCTTCTTCTAGG + Intronic
1117020893 14:51569209-51569231 GCCTCTCAGACATTTCTGTATGG + Intronic
1124069701 15:26379931-26379953 TCCCAGAAGACACTTGTGTTTGG - Intergenic
1124127040 15:26945606-26945628 GCAAATCAGACACATCTGGTGGG - Intronic
1131183054 15:90253558-90253580 GCCCACCAGAAACTTCCTTTGGG - Intronic
1131459164 15:92606422-92606444 GCCCCTCAGACACCTCTTTGGGG - Intergenic
1131964921 15:97831576-97831598 GCTCTTCAGACTCTTCTGTGAGG - Intergenic
1134837910 16:17377317-17377339 GCCCATCAAACAGACCTGTTGGG + Intronic
1135545396 16:23362573-23362595 GCCCAGCAGAGATTTCTGTAGGG + Intronic
1139717534 16:68825514-68825536 GCCCAGCAGACATTTCTGGAAGG - Intronic
1140928660 16:79607049-79607071 GCCCAACAGACACCTCTCTTGGG + Intergenic
1142541907 17:666313-666335 CTCCTTCAAACACTTCTGTTTGG - Intronic
1145067202 17:19769813-19769835 GTCCATCAGACACTACAGATAGG + Intergenic
1146405267 17:32531163-32531185 GCCAATCAGAGACTTCCGTTGGG + Intronic
1149646806 17:58247020-58247042 TCCCATCAGAGACTTCTGTATGG - Intronic
1150658087 17:67053624-67053646 CCCCAACAGAGACTGCTGTTTGG + Intronic
1153248721 18:3098899-3098921 GCCCATGAGACACGACTGTAGGG - Intronic
1157528736 18:48405014-48405036 GCCCCTGAGACAGTTCTGATGGG + Intronic
1158596531 18:58821513-58821535 GCCTGTAAGAAACTTCTGTTGGG + Intergenic
1167923018 19:52798447-52798469 GACCATCAGACAATTCCTTTTGG - Exonic
1167928131 19:52839547-52839569 GACCATCAGACAATTCCTTTTGG - Exonic
927131725 2:20065976-20065998 GCCCAGCAGACCCTTCTGCCAGG + Intergenic
930109892 2:47669558-47669580 GCCCCTCACACATTGCTGTTGGG - Intergenic
931661685 2:64570789-64570811 GCCCATTAGCCAGTTCTGTGAGG + Intronic
934681629 2:96287795-96287817 TCCCATCAGACCCTTGGGTTGGG + Intronic
935182373 2:100702442-100702464 GCCCATCAGACATTTCTTCCTGG + Intergenic
938706074 2:133928455-133928477 GTCCACCAGATACTTCTTTTAGG + Intergenic
938795282 2:134713669-134713691 GCCCACAAGACCTTTCTGTTAGG + Intronic
945831769 2:214795867-214795889 GCCTACCAGATACGTCTGTTTGG - Intronic
946069924 2:217025443-217025465 GTCCATCACACTCTTCTTTTTGG + Intergenic
946083950 2:217152117-217152139 GGCCATCAGACACATCTGTCTGG + Intergenic
946512781 2:220377381-220377403 ACCCATCAGACACTCCTTCTGGG + Intergenic
1169600006 20:7247747-7247769 CCCCATCAGACACTCTTGATGGG + Intergenic
1177402432 21:20623368-20623390 GCCCCACAGAGGCTTCTGTTTGG + Intergenic
950095547 3:10327910-10327932 GCCCAACAGACACTTCCCCTGGG - Exonic
951022494 3:17796319-17796341 GACCATCAGACATTACTGGTGGG - Intronic
958645983 3:96874743-96874765 GCCAATCAGACTCCTCTTTTAGG + Intronic
962541847 3:136390465-136390487 GCCAATCAGGCACTTGTGATTGG + Intronic
963422601 3:145079350-145079372 GCCAATCAGAAACATCTGTCTGG - Intergenic
963681654 3:148385638-148385660 GCCAATCAGATGCTTCTGTGGGG + Intergenic
969288170 4:6221442-6221464 GCTCATCAGCCACCTCTGCTGGG - Intergenic
969929955 4:10621166-10621188 GCAGGCCAGACACTTCTGTTTGG + Intronic
970962062 4:21883893-21883915 GCCCAATAGAGACTTCTTTTTGG + Intronic
975814555 4:78204025-78204047 GCCCTACAAACACTTGTGTTAGG + Intronic
977501228 4:97840776-97840798 GCCCATCAGTCACTTTTTCTAGG + Exonic
980469082 4:133227920-133227942 GCCCATCTGATACTTCCATTTGG + Intergenic
980888783 4:138792208-138792230 GCCTATTAGACATTCCTGTTTGG - Intergenic
985224505 4:187745481-187745503 AGCTATCAGACACTTCTGTCAGG + Intergenic
986262547 5:6160967-6160989 GCCTCTCAGACAGTTCTGCTGGG - Intergenic
993588933 5:89769622-89769644 ACTCTTCAGACAATTCTGTTAGG - Intergenic
996543484 5:124653724-124653746 GCCCAACAGGGACTTATGTTGGG + Intronic
998417086 5:141953888-141953910 GCCCAAGGCACACTTCTGTTTGG - Intronic
1000075934 5:157786140-157786162 TCCTATCAGACTCTACTGTTAGG - Intronic
1000294914 5:159904893-159904915 GCCCATCAAACACTGATGATAGG - Intergenic
1006631867 6:35435923-35435945 GCCCATCAGAGCCTCCTTTTTGG - Intergenic
1006781297 6:36634161-36634183 GCCCAGCAGGCAGTTCTGTGTGG + Intergenic
1007740503 6:44006681-44006703 GCCCATCAGACACTGATGACAGG + Intergenic
1014009949 6:116463985-116464007 GAACTTCAGACATTTCTGTTAGG + Intergenic
1017838699 6:158204113-158204135 GCTCATGTGACACTTCCGTTTGG + Intergenic
1018970550 6:168525860-168525882 GCCCCTCAGTCACTTCCCTTTGG + Intronic
1020759429 7:12249930-12249952 GCCCATCTGACACTTCATTCTGG - Intergenic
1022537563 7:31107328-31107350 TCTCATCAGAGACTTCAGTTTGG + Exonic
1023159835 7:37286317-37286339 GCCCATCTGACACTAGTGTCTGG - Intronic
1023632731 7:42179908-42179930 GCCCATCAGACACTTCTGTTTGG - Intronic
1023663468 7:42494400-42494422 TCCCATCAGACAACTCTGTCTGG + Intergenic
1024584608 7:50831106-50831128 GTCCAGCAGAAACTTCTGTGAGG + Intergenic
1034923716 7:155104001-155104023 GCCCATCACACACAGCTGCTGGG - Intergenic
1042662913 8:71175487-71175509 GCCCATCAGAAGCTCCTGTATGG - Intergenic
1048068438 8:130996962-130996984 GAACATTAGAAACTTCTGTTAGG + Intronic
1048511881 8:135070382-135070404 CCCCTTCAGACACTGCTGTGGGG + Intergenic
1049042454 8:140123035-140123057 GCCAATCTGACATCTCTGTTTGG + Intronic
1049812135 8:144580359-144580381 GCCCCTCAGACACTGCTCTCAGG + Intronic
1055376070 9:75649110-75649132 CCCCGTCAGACACTACTGTGGGG - Intergenic
1057795584 9:98155031-98155053 AACGATCAGACACTTCTGATGGG - Intronic
1059729816 9:117045724-117045746 CCCCATCAGACCCTTGTGTGTGG + Intronic
1060889384 9:127178303-127178325 GCCCACTTGCCACTTCTGTTCGG - Intronic
1061347265 9:130036723-130036745 ACCCTTCAGAGATTTCTGTTTGG - Intronic
1186104456 X:6191418-6191440 GCCCAGCACACACTTCACTTTGG - Intronic
1187829944 X:23370940-23370962 GGCTATCAGACAATTTTGTTTGG - Intronic
1189199067 X:39176234-39176256 GCCCATCAGGCAGTTGTGCTGGG - Intergenic
1193090935 X:77493476-77493498 GGTTTTCAGACACTTCTGTTTGG + Intergenic