ID: 1023632823

View in Genome Browser
Species Human (GRCh38)
Location 7:42180553-42180575
Sequence GTGGAGTGATGGCCTGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023632815_1023632823 17 Left 1023632815 7:42180513-42180535 CCAGCAGAAAGACAAATCAGGTG 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1023632823 7:42180553-42180575 GTGGAGTGATGGCCTGGAAAAGG 0: 1
1: 0
2: 2
3: 31
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023632823 Original CRISPR GTGGAGTGATGGCCTGGAAA AGG Intronic
900369099 1:2323612-2323634 GTGCAGCGAGGGCCTGGAGAAGG - Intronic
900690414 1:3977407-3977429 CTGGGGTGATGGCCTGGGCAGGG + Intergenic
901712635 1:11127740-11127762 GTGGCATGAAGGCCTGGAAGAGG - Exonic
902813158 1:18901146-18901168 GTGCAGGGAAGGCCTGCAAACGG + Intronic
905111316 1:35596686-35596708 GTGGTGGGATGGTCTGGAAGAGG - Intergenic
905224772 1:36472037-36472059 GTGGAGGGATGGCCTTCAGAGGG + Intronic
905333593 1:37227320-37227342 ATGGAGGTATGGCCTGGAAGTGG + Intergenic
905872811 1:41414858-41414880 GTGGAGTGAAGGCATGGAGAGGG + Intergenic
909231276 1:73093546-73093568 TTGGAGCTATGGCCTGGAATGGG + Intergenic
910559015 1:88569701-88569723 ATGCAAGGATGGCCTGGAAATGG - Intergenic
910620519 1:89248531-89248553 TGGGAGTTAGGGCCTGGAAAAGG - Intergenic
912514123 1:110207444-110207466 GTGGAGGGGGGGCCTGGAAAGGG + Intergenic
912810610 1:112791403-112791425 GTGGAGTGAAGGCCTAAAAGCGG - Intergenic
912876648 1:113366562-113366584 GTGGGGTGATGGGGTGGAATTGG + Intergenic
916214094 1:162381457-162381479 GTGGAGGGATGGCATGGATGAGG - Intronic
916346308 1:163795593-163795615 GTTGAATGAAGGACTGGAAAGGG - Intergenic
917042346 1:170819709-170819731 TTGGACTGTTTGCCTGGAAAGGG + Intergenic
917306198 1:173627976-173627998 TTGGAGTTAGGGCCTGGAATGGG - Intronic
917461756 1:175236389-175236411 CTGTAGTGATGGCTTGGTAATGG - Intergenic
917686315 1:177419683-177419705 GTAGAAGGATGGCATGGAAAAGG - Intergenic
918126280 1:181586972-181586994 GTGGAGTGATTTCCTTGAACAGG + Intronic
919941350 1:202288707-202288729 TTGGAGAAATGGCCTGGATATGG + Intronic
921249283 1:213281392-213281414 GTGGAGGCATGGCCCAGAAAGGG - Intergenic
921789474 1:219273189-219273211 GTTAAGTAATTGCCTGGAAAAGG + Intergenic
922048786 1:221970935-221970957 GATGGGTGATGGCCTGGATACGG - Intergenic
922554981 1:226526165-226526187 GTGGAGAGAGGCCCTGGAAAAGG - Intergenic
922781505 1:228256570-228256592 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922781895 1:228259419-228259441 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
923663371 1:235977976-235977998 CAGTAGTTATGGCCTGGAAAAGG + Exonic
923676802 1:236087484-236087506 GGGGAGTGAGGGGCTGGCAAGGG - Intergenic
924302144 1:242650674-242650696 TTGTAGTGGTGGCCTGGTAATGG + Intergenic
1063568999 10:7197225-7197247 GTGGAGTGAGGGCCTAGGACTGG - Intronic
1063954600 10:11254878-11254900 GGGGAGAGATGGGATGGAAAGGG - Intronic
1064048914 10:12043228-12043250 GTGGATTGGTCGCCAGGAAAGGG + Intergenic
1064594195 10:16926745-16926767 GGGGGGTGGTGGCATGGAAAAGG + Intronic
1064624417 10:17247695-17247717 GTGGAGAAAGGGCCTGGAAAAGG - Intergenic
1064833920 10:19504286-19504308 CTACAGTGATGTCCTGGAAAAGG - Intronic
1065022087 10:21509518-21509540 GGGGAATGATGGCCTGGAAACGG - Intergenic
1065200762 10:23310783-23310805 ATGGAGTGCTGACCTGTAAATGG - Intronic
1065979520 10:30878433-30878455 GTGGAGAGAGGAGCTGGAAAGGG - Intronic
1066656876 10:37704863-37704885 GTGGGGTGAGGTCCTGGAAAGGG + Intergenic
1067041402 10:42955101-42955123 GTGGGGTGAGGTCCTGGAAAGGG + Intergenic
1067740419 10:48891190-48891212 TTGGAGGGATGGCCTGGGACTGG + Intronic
1069500770 10:68951005-68951027 GTGGAGTAATGGTTTGGAAATGG + Intergenic
1073960886 10:108926268-108926290 CTGGAGTGATGGAATGGGAAAGG - Intergenic
1073995816 10:109314271-109314293 CTTCAGTGATGTCCTGGAAAGGG + Intergenic
1074198321 10:111208557-111208579 GTGGAGAGGTGCCATGGAAAAGG - Intergenic
1075058505 10:119237968-119237990 CTGGAGTTAAGGCATGGAAAGGG + Intronic
1076127583 10:127987593-127987615 GAGGCGTGGTGGACTGGAAATGG - Intronic
1076462117 10:130654812-130654834 GTTGAGTCTTGGCCGGGAAAAGG + Intergenic
1077420400 11:2447310-2447332 GTGAAGGGGTGGCCAGGAAAGGG + Intronic
1077552598 11:3207752-3207774 CTGGGCTAATGGCCTGGAAAAGG - Intergenic
1078053907 11:7991484-7991506 GTAGAGTGAAGGTCTGGAATAGG + Intronic
1078077374 11:8174189-8174211 GTGTAGTGAAGGTTTGGAAATGG + Intergenic
1081992964 11:47347505-47347527 CTGCAGTGAGGGACTGGAAAGGG + Intronic
1082619503 11:55402456-55402478 ATGGAGTTATGGCCAGGAAGAGG - Intergenic
1083193439 11:61068780-61068802 GTGGAGTGATCCCATGTAAAAGG + Intergenic
1083298569 11:61728304-61728326 GTGGAGAGGTGACCTGGAGAAGG - Intronic
1084102123 11:66956734-66956756 GAGGAGAAATGGCCTGGAAGGGG - Intronic
1084119187 11:67059057-67059079 GAGGAGTTATGACGTGGAAATGG + Intronic
1085905573 11:80757413-80757435 CTTGAGTTATGGTCTGGAAAGGG + Intergenic
1086950440 11:92885288-92885310 GTGGAATGATGGCCTGGTAATGG - Intronic
1089385184 11:118062637-118062659 GTGGAGGGAGGGCCAGGAGAGGG - Intergenic
1089634025 11:119800896-119800918 GTGCAGGGCTGGGCTGGAAAGGG + Intergenic
1089643293 11:119861508-119861530 GTGGAGGGATGGCCAGGTCAGGG - Intergenic
1090536352 11:127645986-127646008 ATGGAATGGTGGCCTGGACAGGG - Intergenic
1090858457 11:130632044-130632066 GAGTTCTGATGGCCTGGAAAGGG - Intergenic
1090919069 11:131192379-131192401 CTGGAGTGATGGCCAGGAAGTGG + Intergenic
1091294076 11:134460265-134460287 GTGGAGTGATGGGCTGGGGGTGG + Intergenic
1092915769 12:13187786-13187808 GTGGAGTGATGAACTGCACAGGG - Intergenic
1094624285 12:32107565-32107587 GGGGAGTGAGGGCCAGGAAAGGG - Intronic
1095227478 12:39694950-39694972 TTGGAGCTAGGGCCTGGAAAGGG - Intronic
1095712945 12:45309403-45309425 GAGGAGTAATGGTCTGGAAGTGG + Intronic
1097385788 12:58948910-58948932 TTGTAGTGATGGCTTGGTAATGG + Intergenic
1097995919 12:65887929-65887951 TTGGAGTGATGGCAAGGAAGGGG - Intronic
1098339466 12:69436891-69436913 CTGGAGTGATGGCCTAGAGCAGG + Intergenic
1098667368 12:73180645-73180667 CTGGAGCTAGGGCCTGGAAAAGG + Intergenic
1098823361 12:75261440-75261462 GTGGTGTGATGGGTTGGGAAGGG - Intergenic
1099114805 12:78610679-78610701 GCTGAGTGATGGCCTGGAATAGG - Intergenic
1100619982 12:96261764-96261786 TGGGAGTGTTGGGCTGGAAAAGG - Intronic
1105440555 13:20412227-20412249 GTGGAGTGAAAGACTGGAAATGG - Intronic
1107540233 13:41382599-41382621 GAAGAGTGATGGGCTAGAAATGG - Intergenic
1109068244 13:57729135-57729157 ATGGAGTGATGGGCTGATAATGG - Exonic
1109982020 13:69921649-69921671 TTGGAGTGAGGGCATGTAAAAGG - Intronic
1110378820 13:74825771-74825793 GTGCAGTCATTGCCTGTAAAAGG + Intergenic
1110856898 13:80306531-80306553 TTGGAGATCTGGCCTGGAAAAGG - Intergenic
1111186396 13:84741888-84741910 GTGGAGTGAGGGGATTGAAATGG - Intergenic
1111865305 13:93760543-93760565 GTGGACTAATGGGCAGGAAATGG + Intronic
1113508172 13:110831424-110831446 GTGGAGTGAGGGCCTGGGTTAGG - Intergenic
1115017330 14:28633415-28633437 TTAGAGGGCTGGCCTGGAAAGGG - Intergenic
1118740625 14:68737022-68737044 GTGGAGTGGTGGCCTGGCACAGG - Intergenic
1119071823 14:71593633-71593655 GATGAGTAATGGCTTGGAAAGGG - Intronic
1119407082 14:74405670-74405692 GTAGAGTGATGGCCTGCATTTGG - Intergenic
1119554444 14:75542543-75542565 GGGCAGTCATGCCCTGGAAAGGG - Intronic
1120154601 14:81079323-81079345 GTGGAGTGCTGGCCCACAAAAGG - Intronic
1120523279 14:85549068-85549090 GTGGAATGAAGAGCTGGAAAGGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123149535 14:106167526-106167548 CTGGAGGGGTGGACTGGAAAAGG - Intergenic
1123173042 14:106391873-106391895 CTGGAGGGGTGGACTGGAAAAGG - Intergenic
1125068471 15:35522266-35522288 TTCTAGTGATGCCCTGGAAATGG + Intronic
1125767468 15:42145161-42145183 CTGGAGGGATGGAGTGGAAAAGG + Intronic
1126295020 15:47130000-47130022 GTGGAGCTAGGGCCTGGAATGGG + Intergenic
1127008029 15:54592988-54593010 TTGTAGTGATGGCTTGGTAATGG + Intronic
1130202380 15:81843991-81844013 CTGGAGTGAGGTCCTGGAATTGG - Intergenic
1132393984 15:101459072-101459094 GAGGAGAGGTGGCCTGGAGAGGG - Intronic
1133055114 16:3141901-3141923 GAGTGGTCATGGCCTGGAAACGG - Exonic
1134447968 16:14345123-14345145 GTTGAGCGAAGGGCTGGAAACGG - Intergenic
1135901815 16:26466699-26466721 TTGTAGTGATGGCTTGGTAATGG - Intergenic
1136100768 16:27994013-27994035 GTGCAGTGGGGGCCTGGAAGAGG - Intronic
1136680522 16:31959259-31959281 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1136780863 16:32900805-32900827 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1137483752 16:48874645-48874667 GTGAAGGGCTGGCCAGGAAAGGG - Intergenic
1137660775 16:50204166-50204188 ATGCAGCAATGGCCTGGAAAAGG + Intronic
1139583621 16:67887201-67887223 GTGGGGTAATGGCTTGGAATAGG - Intronic
1139711970 16:68782772-68782794 GTGGGGTGAGGGGCAGGAAACGG - Intronic
1140931801 16:79634782-79634804 GTGGAGAGATGCCCAGGAAAAGG - Intergenic
1141369369 16:83472906-83472928 GTGGCCTGATGGCTTGGAAGAGG + Intronic
1141469088 16:84226353-84226375 GTGTAGGGATGGCCTGTGAAGGG + Intronic
1142327380 16:89424732-89424754 GTGGGGAGATGGGCTGGAAGGGG + Intronic
1203083515 16_KI270728v1_random:1164834-1164856 CTGGAGGGGTGGACTGGAAAAGG + Intergenic
1144781541 17:17810724-17810746 GTGGGGTGGAGGACTGGAAAGGG - Exonic
1145272034 17:21409940-21409962 GGGGAGGTTTGGCCTGGAAAGGG + Intronic
1146314064 17:31793558-31793580 ATGAAATGATGGCCTGGAGAGGG + Intergenic
1146514689 17:33480046-33480068 GTGGATTTATGGTCTGGGAATGG - Intronic
1146637599 17:34517935-34517957 GTGGATTGGTTACCTGGAAAGGG - Intergenic
1148913533 17:50955963-50955985 GTGGATTGATGGCCTACAAAGGG + Intergenic
1150223149 17:63508375-63508397 TTGGAGTGATGGCAAGGAAGGGG + Intronic
1150644936 17:66972040-66972062 GTGGAGGGATGGCCCGGAGAAGG + Intronic
1151749470 17:76028418-76028440 GTGAAATGAGCGCCTGGAAAGGG - Intergenic
1153954354 18:10083449-10083471 GTGGACTGATGCCCTCGGAATGG + Intergenic
1156019194 18:32580370-32580392 GTGGGGTGGAGGCGTGGAAAGGG - Intergenic
1157422315 18:47557343-47557365 GCGGAGGGAGGGCCCGGAAACGG - Intergenic
1158439981 18:57467030-57467052 ATGGAGGCATGGCCTGAAAAAGG - Intronic
1158451135 18:57566492-57566514 GGAGAGAGATGGCCTAGAAAGGG - Exonic
1159874671 18:73797181-73797203 CTGGGGTAATGGTCTGGAAATGG + Intergenic
1162765030 19:12914045-12914067 GTGGGGTGAGGGTCTGGAGATGG - Intronic
1163447169 19:17353497-17353519 GTGGAGTGATGGAGGGGAACGGG - Intronic
1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG + Intronic
1167671693 19:50857267-50857289 GTGGAGGGATGTCCTGGAGAAGG - Intronic
1168283939 19:55321213-55321235 GTGGGGAAATTGCCTGGAAATGG - Intronic
924992990 2:330074-330096 GTGGAGTGATGGTGTGGGATTGG + Intergenic
925096062 2:1204127-1204149 CTGGAGGGATTGCCTGCAAACGG + Intronic
925211589 2:2052779-2052801 GTTAAGTGTTGGCCTGGATATGG + Intronic
927039444 2:19213415-19213437 GTGGACTGATGGGCTGGAATGGG + Intergenic
929602470 2:43212983-43213005 GAGGAGTGGTGGCCTGGAAGAGG + Intergenic
930689870 2:54350463-54350485 GTGGAGTGACCACCTGGAGAAGG - Intronic
931234653 2:60403071-60403093 GAAGAGTGTTGGCCTGGAAGAGG + Intergenic
931306163 2:61030857-61030879 GTGGAGGGGTGGGCAGGAAATGG + Intronic
933421023 2:82044423-82044445 GTGAAGTGAGGCCCTGGACAGGG + Intergenic
940024567 2:149192517-149192539 GTGGAGGAATGGCCTGGGATTGG + Intronic
940763940 2:157769351-157769373 GTGGAGAGATGAATTGGAAAGGG + Intronic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
941875127 2:170424225-170424247 CTGGAAGGATGTCCTGGAAAAGG - Intronic
945319754 2:208407312-208407334 GTGGAGTGATGTCCTGGGGCCGG + Intronic
948637465 2:239348706-239348728 GTGGAGGGCTGGCCGGGCAAGGG + Intronic
1168980926 20:2002981-2003003 GTGGAGTGTTGACCTGAAAAAGG - Intergenic
1169689113 20:8310516-8310538 GGACAGGGATGGCCTGGAAAGGG + Intronic
1170332513 20:15229565-15229587 GAGGAGTAATTGCCTGCAAAAGG - Intronic
1172294266 20:33797326-33797348 TTGGAGTGAGGCACTGGAAAGGG + Intergenic
1172470891 20:35194461-35194483 CTGGAGTGATGTCCTGGAGCAGG + Intergenic
1173811892 20:45960835-45960857 CTGGCGTGCTGGCCTGGGAAGGG - Intronic
1174471516 20:50764695-50764717 GCGAACTGCTGGCCTGGAAATGG - Intergenic
1174515741 20:51091152-51091174 GTGGAAAAATGGGCTGGAAATGG - Intergenic
1175755981 20:61530479-61530501 GTGGAGGGATGCCGTGGCAAGGG + Intronic
1176357820 21:5967041-5967063 GTGAAGGGAGAGCCTGGAAAAGG + Intergenic
1177713011 21:24804252-24804274 GAGGAGTGATCACCTGGACAAGG - Intergenic
1177875373 21:26625782-26625804 GTGGAGAGAAGACCTGGAATGGG + Intergenic
1179765698 21:43571510-43571532 GTGAAGGGAGAGCCTGGAAAAGG - Intronic
1180231874 21:46431216-46431238 GTGGAGTGATTTTCTGGAGAGGG + Intronic
1181111978 22:20607570-20607592 GAGGAGTCAGGGCCTGGGAAGGG + Intergenic
1182352443 22:29706475-29706497 GTGAAATGATGGCTTGGAAAGGG + Intergenic
1182740551 22:32564227-32564249 GTGCAGTCATGGCCGGCAAATGG - Intronic
1182999331 22:34842093-34842115 TTTGAGTGATGTCTTGGAAATGG + Intergenic
1183235935 22:36617688-36617710 GTGGTGTGATGGGATGGATATGG + Intronic
1184391684 22:44206834-44206856 GTGGGGAGCTGGGCTGGAAAAGG - Exonic
1184608748 22:45589482-45589504 CTGGGATGATGGCCTGGAAAAGG + Intronic
951105236 3:18734591-18734613 GTGGAGGGAGGCCCTGGAAGAGG - Intergenic
951435705 3:22661234-22661256 GTTGAGTGGTGGCCAGGAATTGG + Intergenic
951883179 3:27499240-27499262 GAGGGGTGAGGGACTGGAAATGG + Intergenic
952584363 3:34873120-34873142 GGAGAGAGATGGCCTGGAAAGGG + Intergenic
952688412 3:36175720-36175742 GTGGAGCTAGGGCCTGGAATGGG + Intergenic
953547674 3:43875529-43875551 GTGGAGTGATCTCCATGAAAAGG - Intergenic
954630767 3:52046582-52046604 GTGGAGCGATGACCTTGAAGGGG - Intergenic
954693773 3:52409904-52409926 GGGGAGGGAGGGCCTGGACATGG - Exonic
957810443 3:85214895-85214917 CAGGAGTCATGGCCTGGAATTGG + Intronic
957977146 3:87461060-87461082 CAGGAGTTAGGGCCTGGAAACGG - Intergenic
958136249 3:89497275-89497297 GTGGAGTGAGGGACTGCAAAAGG - Intergenic
960767877 3:121157602-121157624 GTGGAATTGTGGTCTGGAAAGGG - Exonic
964011135 3:151893221-151893243 GGGGAGAGTGGGCCTGGAAACGG - Intergenic
966073916 3:175912491-175912513 GAGCAGTGATGGAGTGGAAATGG + Intergenic
966676913 3:182599572-182599594 GAGGAGAGAAGGCCTGGAGAAGG - Intergenic
966793799 3:183695943-183695965 GTGGGCTGATGGCCAGGGAATGG - Intergenic
967117443 3:186354792-186354814 GAGGAGTTATGCCCTGGAGAAGG + Intronic
967323029 3:188212761-188212783 GTGGACTGAGGGCCTGCAAGAGG + Intronic
967951944 3:194847996-194848018 GTGGAGTGAAGGGCTTTAAAAGG - Intergenic
968647632 4:1748436-1748458 GTGGAGTGATGGGCTGGAGGAGG - Intergenic
969924627 4:10574597-10574619 GTGGCGTGAGGGTCTGGGAAAGG - Intronic
970011526 4:11464846-11464868 GGGGACTGGTGGCCTGGAGAAGG - Intergenic
971583531 4:28374914-28374936 GTGGAATGTTGGCTTGGAAATGG + Intronic
971757401 4:30721248-30721270 GTGGAGAGTTGGCCGGGAATGGG - Exonic
973605689 4:52585266-52585288 TTTGGGTGATGGACTGGAAAGGG + Intergenic
974521740 4:62989676-62989698 GTTGAGTGATGGACTGAAATAGG + Intergenic
974904335 4:68036945-68036967 GATGCGTGATGGCCTGGATATGG - Intergenic
975008552 4:69321255-69321277 GTGATGAGATGGCCAGGAAAGGG - Intronic
976542312 4:86292900-86292922 GTAGCCTGATGGCCTGGACACGG - Intronic
976658087 4:87510597-87510619 GTGGAGAGGTGAGCTGGAAAGGG - Intronic
976708398 4:88042563-88042585 GTGGAGGGATGGATTAGAAAAGG - Intronic
976737028 4:88320668-88320690 GTGGAGTGCTGTCCTGGGAGTGG + Intergenic
977677465 4:99763694-99763716 GTGAACTGATAGCCTTGAAAAGG + Intergenic
978837887 4:113175481-113175503 GAGGAGTGCTGGGCTGGAGAGGG - Intronic
986060084 5:4179828-4179850 GTGGAGTTATGGGCTTGAAGTGG - Intergenic
986325672 5:6671848-6671870 GTGGAGAGAGGACCTGGAATAGG - Intergenic
986670800 5:10140850-10140872 GTGCAGGGAAGGCCTGGAAGGGG + Intergenic
987258512 5:16180286-16180308 GGGGAGCGAGGGCCTGGAAGTGG - Intronic
987568467 5:19624611-19624633 GATGAGTGCTGTCCTGGAAATGG + Intronic
990688940 5:58340400-58340422 GTGTAGTGATGGCCTGGGTGGGG + Intergenic
990712658 5:58602992-58603014 TTGTAGTGATGGCTTGGTAACGG + Intronic
991778500 5:70109485-70109507 GTGGTGAGCTGGCCTTGAAAGGG - Intergenic
991857790 5:70984952-70984974 GTGGTGAGCTGGCCTTGAAAGGG - Exonic
991870947 5:71109838-71109860 GTGGTGAGCTGGCCTTGAAAGGG - Intergenic
992435377 5:76750996-76751018 GAGGAGGGATGGGCTGGAGAGGG + Intergenic
992636071 5:78727010-78727032 GAGGAGTGGTGGTCTGGAATGGG + Intronic
995006152 5:107198295-107198317 GTGGAGAAATGGCTTGGAAGGGG + Intergenic
999226744 5:150031919-150031941 GGTGAGTGAAGGCATGGAAAAGG - Intronic
1000381027 5:160629419-160629441 GTGGGGTGATGGCCTGCTTATGG + Intronic
1001447619 5:171797915-171797937 CTGGAGTGCTGTCCCGGAAAGGG + Intergenic
1001893102 5:175355849-175355871 ATTTAGTGATGGCCTAGAAATGG + Intergenic
1002093795 5:176819132-176819154 GGGGAGGGCTGGCCAGGAAAGGG - Intronic
1002107831 5:176888894-176888916 GTGGACTGAGGGCTTAGAAAAGG - Intronic
1003123927 6:3340126-3340148 CAGGAGGGATGGCCTGGAGAAGG + Intronic
1003277902 6:4667917-4667939 GTGGAGTGATTTGCTGGAAGGGG - Intergenic
1003324690 6:5083481-5083503 TGGGAGTGATGTCCTGTAAAGGG - Intergenic
1003874820 6:10426108-10426130 CAGGTGTCATGGCCTGGAAATGG + Intergenic
1007723906 6:43902697-43902719 ATGGAGTGAGGGGCTGGCAAGGG - Intergenic
1009453352 6:63826705-63826727 TTGTAGTGATGGCTTGGTAATGG - Intronic
1010826570 6:80483465-80483487 GATTAGTGATGGCCTGGATACGG + Intergenic
1011328900 6:86182370-86182392 TTGTAGTGATGGCTTGGTAATGG + Intergenic
1012244151 6:96907822-96907844 GTGGAGTTAGGGGCTGGCAAAGG - Intergenic
1016063482 6:139654928-139654950 GTGGAGTGAGGACGTGGGAATGG + Intergenic
1016232643 6:141825161-141825183 GGGGAGTTGTGGACTGGAAAAGG - Intergenic
1016689461 6:146919850-146919872 GTTGTGTGAAGGACTGGAAAAGG - Intergenic
1016830833 6:148431575-148431597 GTGGAATGATTTCCTGGCAAGGG + Intronic
1016860509 6:148714262-148714284 GTGGGGTGTTGTCCTGGAAGGGG + Intergenic
1017634137 6:156426977-156426999 GTGGAGAGATTGCGTGGAGAAGG + Intergenic
1018980932 6:168601292-168601314 GTGGAGCGCTGGCCAGGAAGGGG - Intronic
1019177593 6:170168081-170168103 GTGGAGTGCTGCACTGGAACAGG + Intergenic
1019703775 7:2487895-2487917 GGGGAGGGTGGGCCTGGAAATGG + Intergenic
1019967695 7:4513538-4513560 GGGGAGGAATGGCCTGGAAATGG - Intergenic
1020786545 7:12580560-12580582 GTTGAGTGCTGGCCAGGAATGGG - Intronic
1021661055 7:22918295-22918317 GATTAGTGATGGCCTGGATATGG - Intergenic
1023093022 7:36633754-36633776 GTGGGAAGATGGCCTGGAGAAGG + Intronic
1023452337 7:40300912-40300934 GTGAAGTGATGGCCATAAAATGG + Intronic
1023632823 7:42180553-42180575 GTGGAGTGATGGCCTGGAAAAGG + Intronic
1024587353 7:50853665-50853687 GGGGAGTAAAGGTCTGGAAAGGG - Intergenic
1026101450 7:67387806-67387828 GAGGAGTGATGGCTTAGACATGG + Intergenic
1027050129 7:75016568-75016590 GTGGAGGGGAGGCCAGGAAAAGG - Intronic
1027807050 7:82840314-82840336 GTGGAGTGTGAGCGTGGAAATGG - Intronic
1028197350 7:87922217-87922239 TTGTAGTGCTGGCTTGGAAATGG - Intergenic
1029382906 7:100225100-100225122 GTGGAGGGGAGGCCAGGAAAAGG + Intronic
1029638338 7:101801295-101801317 GTGGTGTGATGAGCAGGAAAAGG - Intergenic
1029646199 7:101857658-101857680 GAGGGGTGACGGCCTGGCAAAGG - Intronic
1030948359 7:115756556-115756578 GTCCAGTGATAGACTGGAAAAGG - Intergenic
1031329783 7:120450439-120450461 ATGGGGTGATGGAGTGGAAAAGG + Intronic
1032584702 7:133135403-133135425 CTGGAGTGAAGAGCTGGAAAAGG + Intergenic
1032584942 7:133137731-133137753 GTGGAGGGATGAACTGGCAAAGG + Intergenic
1033473286 7:141667807-141667829 CAGGAGTGATGCCTTGGAAAGGG - Intronic
1034628767 7:152514605-152514627 TTGGAGTGCTGGCCCAGAAAAGG - Intergenic
1034893103 7:154857809-154857831 GTGAAGTGCTGGCCTGACAATGG - Intronic
1037911940 8:22748791-22748813 GTGTAGTGGTGGCCGAGAAAAGG - Intronic
1041542028 8:58995989-58996011 GGGGAGAGCAGGCCTGGAAACGG - Intronic
1042392905 8:68256437-68256459 ATGGAGTGAAGGGCTTGAAAGGG + Intergenic
1042491353 8:69402222-69402244 GTGAAGTGCTGGCCAGGAAGTGG - Intergenic
1042707759 8:71679955-71679977 GATTAGTGATGGCCTGGATACGG - Intergenic
1048074353 8:131052845-131052867 GTGAAGTGATGGCCCTGAATGGG + Intergenic
1048199094 8:132356783-132356805 GTTGAGTGATGGCCCAGGAATGG + Intronic
1048546212 8:135389681-135389703 GGGGAGGGATGGCAGGGAAAGGG + Intergenic
1050122025 9:2317432-2317454 TAGGAGTTAGGGCCTGGAAAGGG + Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1051234078 9:14980164-14980186 GAGGAGGGATGCCCTGGATATGG - Intergenic
1051601891 9:18883062-18883084 ATGGATTGAAGGCCTGGAATAGG - Intronic
1051980148 9:23004520-23004542 GTGGAGTGATGGAGTGGGAGGGG + Intergenic
1052218490 9:25994157-25994179 TTGTAGTGCTGGCCTGGAAGTGG - Intergenic
1053387221 9:37702610-37702632 CTGGAGTGAAGGCCTGGGAAGGG + Intronic
1056522832 9:87415966-87415988 GATTGGTGATGGCCTGGAAATGG - Intergenic
1057112344 9:92485158-92485180 TTGGAATGATAACCTGGAAAAGG - Intronic
1057700901 9:97362468-97362490 GTGGGGGGATGGACTGGGAAGGG - Intronic
1058158194 9:101538484-101538506 GTGGGGTAATGGCCTGGAAGTGG + Intronic
1058505369 9:105660978-105661000 GTAGAGTCAGGGCTTGGAAAGGG + Intergenic
1060436207 9:123595323-123595345 GTGGATCGATGGCCAGGAAAGGG - Intronic
1061910252 9:133718664-133718686 GTGGAGTGATGACCTCAGAAGGG - Intronic
1062088569 9:134661857-134661879 CTGGAGGGAAGGGCTGGAAAGGG - Intronic
1062690157 9:137837512-137837534 GGGGAGTGCAGGCCTGGGAAGGG + Intronic
1186447797 X:9646641-9646663 TTGGAGGGATGGCCTGGACAAGG - Intronic
1186626432 X:11298707-11298729 ATGGAGTGTTGGCCAGGAACGGG - Exonic
1190911615 X:54776646-54776668 TGGGAGTTAGGGCCTGGAAAGGG - Intronic
1191207476 X:57849837-57849859 TGGGAGTGAGGGCCTGGAATGGG + Intergenic
1192317700 X:70065712-70065734 GTGGAGAGAAGGGCAGGAAAGGG + Intergenic
1192433468 X:71127820-71127842 GTCGAGGGATGGTCAGGAAAGGG - Intronic
1194307023 X:92259890-92259912 GGGGAGTTAGGGCCTGGAACGGG + Intronic
1195293448 X:103451429-103451451 GAGCAGTGGTTGCCTGGAAATGG - Intergenic
1195502047 X:105613176-105613198 CAGGAGAGATGGCCTGGAAATGG - Intronic
1196215139 X:113041850-113041872 GTGTAGTGGAGGGCTGGAAATGG - Intergenic
1197124922 X:122932923-122932945 GTGAAGAGCTGGCCTGGAGAAGG - Intergenic
1197186316 X:123591261-123591283 GGGGAGAGAGGGCCTGGACAGGG - Intergenic
1197266063 X:124373251-124373273 TCGGAGTGATTCCCTGGAAAAGG + Intronic
1197429402 X:126342238-126342260 GAGGAGATAGGGCCTGGAAAGGG - Intergenic
1197596105 X:128465880-128465902 GTGCAATGATGGCATTGAAAGGG + Intergenic
1198308706 X:135407653-135407675 GTGGAGTGATGCTCTTGAGAAGG - Intergenic
1198542702 X:137656992-137657014 CTGGAGCAATGGCCTGGTAAGGG + Intergenic
1198702612 X:139414071-139414093 CTGGAGCTAGGGCCTGGAAAGGG + Intergenic
1201176697 Y:11314268-11314290 CTGGCGTGATGGCCTGAAGATGG - Intergenic