ID: 1023633260

View in Genome Browser
Species Human (GRCh38)
Location 7:42184113-42184135
Sequence CATGCTAAGCACTCTCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023633256_1023633260 27 Left 1023633256 7:42184063-42184085 CCGAGGATTAGATGCGTCACTCA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1023633260 7:42184113-42184135 CATGCTAAGCACTCTCTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023633260 Original CRISPR CATGCTAAGCACTCTCTAGG AGG Intronic
904129628 1:28266118-28266140 TATGCTAAGTGCTTTCTAGGTGG - Intronic
904575609 1:31503301-31503323 TATGCTAAGCACACTGCAGGGGG + Intergenic
910327212 1:86024036-86024058 CATCCTAAGCCCTCTCTATTAGG + Intronic
919912272 1:202118905-202118927 CATGCTGGGCACCCTCCAGGGGG + Intergenic
920201560 1:204262780-204262802 CATGCTAAGCCCTCTGCTGGAGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
924199727 1:241646293-241646315 CATGCTGAACACTCTCTCTGTGG + Intronic
1073219550 10:101858801-101858823 GATGCTTAGCACTCTGAAGGAGG + Intronic
1075716524 10:124558864-124558886 CTTGCCAAGCACTCTTTGGGAGG + Intronic
1080564370 11:33494476-33494498 CATGTTAAGTAATCTCTAGCAGG - Intergenic
1081149135 11:39604919-39604941 CATGCTAAAAACTCTCAATGAGG + Intergenic
1081801449 11:45862316-45862338 CATGGTAAGTACTCTCTAAATGG - Intronic
1086379668 11:86239069-86239091 TGTGCTAGGCACTTTCTAGGTGG - Intergenic
1094804964 12:34081462-34081484 GCTGCTATGCACTCCCTAGGAGG - Intergenic
1103755061 12:123198306-123198328 CATGCAAAGCACTATCTAATTGG + Exonic
1105284178 13:18991392-18991414 AATGCTAAGCCCTCTCTATGAGG + Intergenic
1105284355 13:18992575-18992597 AACGCTAAGCCCTCTCTATGAGG - Intergenic
1111177879 13:84621517-84621539 GATGCTGAGGACTATCTAGGGGG - Intergenic
1113381383 13:109809243-109809265 CTTGATAAGCACTCACTAAGTGG + Intergenic
1116499309 14:45601160-45601182 CATGCATAGGACTCTCTTGGAGG + Intergenic
1116632722 14:47355559-47355581 CAGGCTTTGCACTCTCTAGGTGG + Intronic
1120772312 14:88393418-88393440 CAGACTAAGCACTCTCCAGCTGG + Exonic
1121801853 14:96781079-96781101 CATGCTCAGCCCTTTCTGGGAGG - Intergenic
1125335883 15:38625874-38625896 TATGCTAAGCACTCAATAGATGG - Intergenic
1130578441 15:85114221-85114243 CAAGCTAAGCTCTCCCTAGGAGG - Intronic
1131634176 15:94212533-94212555 AATGCTAAGGAGGCTCTAGGGGG + Intergenic
1131969114 15:97874639-97874661 CATGGTAAGCACTCACTGTGTGG - Intergenic
1134535047 16:15019611-15019633 CATGCAAGGCACTATCTATGAGG - Intronic
1137609943 16:49811446-49811468 CCTGCTAAGCACACTCTGGGTGG - Intronic
1139376233 16:66498938-66498960 CATTCAAAGCAGTCTGTAGGGGG + Intronic
1140630266 16:76844149-76844171 CATGTTGAGCACTCTGTAAGAGG + Intergenic
1140977993 16:80079299-80079321 ATTGCTAAGCACTCTCTTGTTGG + Intergenic
1146137978 17:30339998-30340020 CATCATAGGCACTTTCTAGGTGG - Intergenic
1148185479 17:45640396-45640418 CATGGGAAGCCCTCTCTAGGAGG + Intergenic
1149211399 17:54305941-54305963 CATTCTAAGAATTCTCTAGATGG - Intergenic
1158285244 18:55873602-55873624 CCTGCTTAGAAATCTCTAGGTGG + Intergenic
936578551 2:113675581-113675603 CATTCTCTGCACTCTCTTGGAGG + Intergenic
937821189 2:126313026-126313048 TGTGCTAGGCACTTTCTAGGTGG - Intergenic
945869900 2:215215848-215215870 TTTGCTAAACACTCTCTTGGGGG - Intergenic
946449650 2:219768993-219769015 TATGATAAGGACTCTCCAGGAGG - Intergenic
947707064 2:232284893-232284915 CCTGCTAAGCATTCTCTCTGTGG - Intronic
1170502046 20:16984060-16984082 AGTGATAAGCGCTCTCTAGGAGG - Intergenic
1171167427 20:22984279-22984301 CATGTTAGGCAGTCTCTTGGGGG + Intergenic
1175328262 20:58144738-58144760 TGTGCTGAGCACTCTCCAGGTGG + Intergenic
1182060586 22:27394357-27394379 CACGCTAAGCACTTTACAGGCGG + Intergenic
1182827890 22:33281622-33281644 CATGCTAAGCACACAATAAGTGG + Intronic
1184292003 22:43502386-43502408 CATGCTGAGCTCTTTCAAGGAGG + Intronic
1184951694 22:47847658-47847680 CATGCAAAGCACTCTCTGCTGGG + Intergenic
949507405 3:4740496-4740518 CTTGCTAGGCACTCTCATGGAGG + Intronic
950934324 3:16823173-16823195 CAGGCTAGGCACTTTCTGGGAGG + Intronic
952184746 3:30956586-30956608 CATTATAAGCACTCTCTAAATGG - Intergenic
954613953 3:51960083-51960105 CAGGCTCAGAGCTCTCTAGGTGG + Intronic
958051589 3:88354344-88354366 CATGATAAGCACTCAATAAGAGG + Intergenic
959445234 3:106431410-106431432 CATGCTAAGCACTCTTCTAGGGG + Intergenic
962025087 3:131539447-131539469 CATGCTAAGCAACCTGTGGGTGG - Intronic
962393504 3:134993523-134993545 CAAGCTCAGCACTTTCTTGGGGG + Intronic
963508477 3:146217803-146217825 CATGAGAAGCAGTCTATAGGTGG + Intronic
965178503 3:165367517-165367539 CATGCAAAGGACTCACTTGGAGG + Intergenic
970289248 4:14553426-14553448 CATGCTAGGCATACTCTAGCTGG - Intergenic
977318161 4:95477479-95477501 CATTCTAAGCACTGTCTAAAGGG + Intronic
978533070 4:109733442-109733464 CAAGCTAGCCACTCTCTAGCAGG - Intergenic
980137645 4:128874642-128874664 CATGCTGGGAACTCTCTATGAGG + Exonic
982595117 4:157372877-157372899 CATGATACGCTCTCTCTACGTGG - Intergenic
983664035 4:170162649-170162671 CATTCTAAGAACTAACTAGGTGG - Intergenic
983766616 4:171491905-171491927 CATATTTAGCATTCTCTAGGTGG - Intergenic
986301677 5:6482622-6482644 ATTGCCAAGCACTCCCTAGGGGG - Intronic
988068015 5:26247472-26247494 CATCTTAAAAACTCTCTAGGTGG + Intergenic
991684435 5:69168442-69168464 CATGCTAAGCACTCAATAAATGG - Intronic
993616236 5:90115780-90115802 CATGCCAGGCACTGTCTTGGTGG - Intergenic
997648845 5:135499982-135500004 CATGCCAAGCGCTTTATAGGTGG - Intergenic
997742236 5:136266460-136266482 CATGTTAAACTGTCTCTAGGTGG + Intronic
999412913 5:151367886-151367908 CTTGCTAATAACTCTCTATGGGG + Intergenic
1006588943 6:35140697-35140719 CACACTAAGCACCCCCTAGGGGG + Intronic
1008515906 6:52319043-52319065 TAAGCTAAGCACTCTCTTAGAGG + Intergenic
1011365067 6:86572549-86572571 CATTCAAAGCAGTCTGTAGGGGG + Intergenic
1012384061 6:98656753-98656775 CATGCTAGTCCTTCTCTAGGTGG - Intergenic
1013535383 6:111058878-111058900 CATTCTAAGTTCTCTCTAGTTGG + Intergenic
1015547960 6:134381209-134381231 CAGGCTCAGCACTCTTTTGGAGG - Intergenic
1018635657 6:165857144-165857166 GATGCTAAGCATTCTCTTGGTGG - Intronic
1020678817 7:11211491-11211513 CATCCTAAGCATTTTCTAAGAGG + Intergenic
1023633260 7:42184113-42184135 CATGCTAAGCACTCTCTAGGAGG + Intronic
1026275662 7:68873562-68873584 GATGCCAAGCCCTCTCTAGCTGG + Intergenic
1026295365 7:69047494-69047516 CAGGCTAAGGCCTCCCTAGGGGG + Intergenic
1031047507 7:116908700-116908722 TATGCTAAGGACTCACTAGCTGG + Intronic
1038533845 8:28339689-28339711 CATGGTAACCAGTCTCTAGCCGG - Intronic
1041531794 8:58876795-58876817 CATGCCAAGCACTCTGCTGGTGG + Intronic
1043461109 8:80461170-80461192 CGTGCTATGAACTCTCTAGAGGG - Intergenic
1044349874 8:91151237-91151259 CATGCAAAGCACTGTGTAGAGGG - Intronic
1044353591 8:91194995-91195017 CATGCAAAGCACTGTGTAGAGGG - Intronic
1055062297 9:72082358-72082380 CATGCAATGCACTCCCTAGAGGG + Intergenic
1188459262 X:30404512-30404534 CATGCTCAGTAATCTCTTGGTGG + Intergenic
1192453078 X:71255307-71255329 CATGCTAAGGACCATCCAGGAGG - Intergenic
1200017642 X:153178989-153179011 CATGCTCAGGATTCTCAAGGAGG + Intergenic
1201645017 Y:16221014-16221036 CATGCAAAGCAGTCTGTAGAGGG - Intergenic
1201657797 Y:16364308-16364330 CATGCAAAGCAGTCTGTAGAGGG + Intergenic