ID: 1023634651

View in Genome Browser
Species Human (GRCh38)
Location 7:42197613-42197635
Sequence CTCAGTACAGAGAAGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023634642_1023634651 16 Left 1023634642 7:42197574-42197596 CCAAATGAAATGTCGTGCTACTG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG 0: 1
1: 0
2: 0
3: 26
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023634651 Original CRISPR CTCAGTACAGAGAAGGATGG GGG Intronic
900996317 1:6125262-6125284 CCCAGGACAGAGAGGGGTGGGGG + Intronic
901004383 1:6164829-6164851 CTCAGTAGAGAGAAGGAGAGAGG + Intronic
902267610 1:15279469-15279491 CCCGGTACAGAGAAAGAGGGAGG - Intronic
902891091 1:19444247-19444269 CTCAGGAGAGAGAGGGATTGAGG - Intronic
902938338 1:19780919-19780941 CACACTACAGACCAGGATGGAGG + Intronic
903318358 1:22526466-22526488 CTCAGGACAGCCAGGGATGGAGG - Exonic
905255306 1:36677925-36677947 TTTGGTACAGAGAAGAATGGAGG + Intergenic
907988580 1:59556946-59556968 CCAAGTACAAAGCAGGATGGGGG - Intronic
908684105 1:66695322-66695344 CTCACTATAGGGAAGGGTGGAGG - Intronic
910719857 1:90274111-90274133 CTCCATACAGTGAAAGATGGTGG + Intergenic
912190004 1:107327044-107327066 CTGAGTCCAGAGAAGGAGGGAGG - Intronic
912852671 1:113140700-113140722 TTCAGTACAGAGAATGGTGGTGG + Intergenic
913191360 1:116416007-116416029 CTCAGGACACAGAAGGGTTGGGG + Intergenic
917700078 1:177571521-177571543 ATCAGTCCAGAGTAGGATGAGGG + Intergenic
919531395 1:198725599-198725621 CTCAGTACAGGGAAGGGATGAGG - Intronic
919663073 1:200266977-200266999 CTCAGTAGAGAGTAACATGGTGG + Intergenic
919941235 1:202287824-202287846 CCCAGGTGAGAGAAGGATGGCGG - Intronic
920378739 1:205523436-205523458 CTCAGGACAGAGAGGCAGGGAGG + Intronic
920433788 1:205935526-205935548 CTCAGTACAGATGAGGTTGTAGG + Intronic
922504816 1:226120438-226120460 CTCTGGACACAGAGGGATGGAGG - Intergenic
923360986 1:233210937-233210959 CTCAGTGCAGAGAAGGAGCAAGG + Intronic
923984138 1:239361385-239361407 CTGTGTACAGAGAAAGATGCAGG + Intergenic
924704206 1:246486017-246486039 CTCAGTATAGAGGAGGATGATGG - Intronic
1065708291 10:28491370-28491392 CTCAATAGAGAGAGGGAGGGAGG + Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068984336 10:63093118-63093140 CTGAGTAGAGAGTAGAATGGTGG - Intergenic
1069665221 10:70150609-70150631 CTCCGAACAGAGAAGTATGGGGG + Exonic
1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG + Intronic
1071464021 10:85923276-85923298 CTCAGGTCACTGAAGGATGGTGG + Intronic
1072150512 10:92679232-92679254 CTCCTTAAAGTGAAGGATGGTGG + Intergenic
1073172698 10:101525180-101525202 CTCAGTACAGATTTGGGTGGTGG + Intronic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1073542269 10:104323883-104323905 CACAGTAAAGAGCAGGAAGGTGG - Intronic
1073838480 10:107471333-107471355 CCCAGTACAGAGACAGAGGGAGG + Intergenic
1074060122 10:109957633-109957655 CTCATTACAGAGCAGGACGGTGG + Intergenic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1076535418 10:131173939-131173961 CTCAGGACTGGGAAGGAGGGAGG + Intronic
1078531618 11:12140877-12140899 CTCAGTCTAGAGAAGGTTGGTGG - Intronic
1078564584 11:12403425-12403447 CTGGGCACAGAGAAGGCTGGGGG - Intronic
1078632051 11:13011313-13011335 CTCATTAAAGAGAGGGAAGGAGG + Intergenic
1080725681 11:34897965-34897987 CCCTGTACAGAGATGGAGGGTGG - Intronic
1084636190 11:70394425-70394447 CTTAGTACCGAGGAGGGTGGGGG + Intergenic
1085837578 11:79973180-79973202 CTCACCACAGAGATGGCTGGGGG - Intergenic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086149633 11:83594257-83594279 CTCAGTACTCACAATGATGGAGG - Intronic
1086537431 11:87865099-87865121 CCAAGAACAGGGAAGGATGGAGG + Intergenic
1087071424 11:94085063-94085085 CTTAGTAGAGAGCAGGAGGGGGG + Intronic
1087571185 11:99929245-99929267 CTCAGAAGACAGAAAGATGGGGG - Intronic
1087779307 11:102286293-102286315 CTCACTTCAGGGAAGGAAGGTGG - Intergenic
1087856067 11:103092688-103092710 CTCAGTAGAGAGAAATTTGGGGG + Intergenic
1089124635 11:116168135-116168157 CTCAGTACATCCAAGGATTGGGG - Intergenic
1089327005 11:117664140-117664162 CTCAGTCCAGAGAGGAATGGTGG + Intronic
1089505343 11:118958504-118958526 CTTAGTTCACTGAAGGATGGGGG - Exonic
1091048755 11:132349244-132349266 CTGGGTGCAGAGCAGGATGGAGG - Intergenic
1091049790 11:132356901-132356923 CTCAGTCCACAAAAGGAAGGAGG - Intergenic
1091785448 12:3240471-3240493 CTCAGCACAGTTAAGAATGGTGG + Intronic
1095169817 12:39020517-39020539 CTCAGCAGAGAGAGGGAAGGAGG + Intergenic
1095554107 12:43480763-43480785 ATAAGTAGAGAGAAGAATGGTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1098167657 12:67714649-67714671 CCCAGTACAGAGACAGAGGGTGG - Intergenic
1100292896 12:93234614-93234636 CTCAACAAAGAGAAGGATGGGGG + Intergenic
1101018295 12:100525119-100525141 CTCAGTACAGTGGAAGATGGAGG - Intronic
1102057117 12:109905073-109905095 CTCATTACAGGGCAGGATGCAGG + Intronic
1102077283 12:110069704-110069726 ATGAGAACAGAGAATGATGGAGG + Intronic
1102193813 12:111009613-111009635 CTCAGGACAAAGCAAGATGGTGG - Intergenic
1103104598 12:118212551-118212573 CTCAGGACAGAGCTGGCTGGTGG - Intronic
1104269691 12:127272041-127272063 CTCAGCCCAGAGCAGGATTGAGG - Intergenic
1104670249 12:130675416-130675438 CTCTGTGCAGAGCAGGCTGGCGG - Intronic
1105439639 13:20404593-20404615 CTCACTGCAGAGAAGCATGTTGG - Intronic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108901690 13:55417816-55417838 CTCTGTACAGAGACAGAGGGAGG - Intergenic
1112651989 13:101409478-101409500 CTCAGCACAGGGTAGGACGGTGG - Intronic
1113108040 13:106792173-106792195 CTCAGGACAGAGAATGAAGATGG - Intergenic
1113373186 13:109741034-109741056 ATCGGTGCAGAGAAGGCTGGTGG + Intergenic
1114283888 14:21221588-21221610 ATAACTACAGAGCAGGATGGTGG + Intronic
1117488117 14:56219271-56219293 CCCCGTACAGAGACAGATGGGGG + Intronic
1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG + Intronic
1119372244 14:74156828-74156850 CTAAGTACAGAGTAGAATAGTGG - Intronic
1122074509 14:99227491-99227513 CTCAGAACAGGGAAGGATTCTGG + Intronic
1122357346 14:101131638-101131660 CTCAGTTCAGAGCTGGCTGGGGG + Intergenic
1122408758 14:101515360-101515382 CTGAGGACAGACATGGATGGTGG - Intergenic
1124108983 15:26769766-26769788 CACAGAACAGAGAGGGAGGGAGG - Intronic
1129150698 15:73685856-73685878 CTGAGTGCAGGGCAGGATGGAGG + Intronic
1129382037 15:75174185-75174207 CTCATTCCAGGGAAGCATGGAGG - Intergenic
1130102691 15:80905888-80905910 CTCAGTACAGAGTTGGGTGGAGG + Intronic
1130754120 15:86744685-86744707 CTCAGTGCAAAGAGGGAGGGTGG - Intronic
1130911405 15:88273453-88273475 ATCTGTACAGACAAGGATGGAGG - Intergenic
1132500097 16:281263-281285 CCCAGTCCAGAGCAGGGTGGTGG + Intronic
1132955707 16:2592256-2592278 CTCTGCACAGAGGAGGATGCAGG - Intronic
1133309693 16:4836559-4836581 GTCATTACAGAGAAGGAAAGCGG + Intronic
1133367533 16:5222318-5222340 CTCAATCCAGAGAAAGAGGGTGG + Intergenic
1134088017 16:11371901-11371923 CTCAGTGCAGAGAGGGCTCGAGG + Intronic
1136154431 16:28373742-28373764 CTCAGTCAAGAGAAGGGTGGGGG - Intergenic
1136208659 16:28741522-28741544 CTCAGTCGAGAGAAGGGTGGGGG + Intergenic
1136748057 16:32609614-32609636 CTCAGGTCAGATTAGGATGGAGG + Intergenic
1136995948 16:35188106-35188128 CTCAGTGCTGAGAATGTTGGGGG + Intergenic
1141508448 16:84496419-84496441 CCCTGTACAGAGACGGAGGGAGG - Intronic
1203050194 16_KI270728v1_random:868821-868843 CTCAGGTCAGATTAGGATGGAGG + Intergenic
1142507001 17:370847-370869 GTAAGTACAGAGGAGGCTGGTGG - Intronic
1142931088 17:3284551-3284573 CCTAGGAGAGAGAAGGATGGGGG + Intergenic
1142944324 17:3411956-3411978 CCTAGGAGAGAGAAGGATGGGGG - Intergenic
1146064699 17:29625035-29625057 CTCTTTAAAGAGAAGGAGGGTGG - Intergenic
1146483977 17:33228750-33228772 TCCAGTACAGGGAAGGATAGTGG - Intronic
1146943176 17:36857997-36858019 CTCACTCCAGAGAAGGAACGCGG - Intergenic
1147514113 17:41099929-41099951 CTCAGCACAGAGAACACTGGTGG + Intronic
1147516210 17:41120146-41120168 CTCAGCACAGAGAACACTGGTGG + Intergenic
1148151879 17:45401969-45401991 CTCAGTACCTAGAAGGTTTGAGG - Intronic
1150137001 17:62701608-62701630 TTCAGTAAAGAGGAGGAGGGAGG + Exonic
1150419929 17:65024326-65024348 CTCATTACAGATCAGAATGGAGG + Intronic
1151337173 17:73446843-73446865 CCCAAGACAGAGAAGGAGGGAGG - Intronic
1152477296 17:80526578-80526600 CTCAGAGCAGAGAAGGACAGAGG - Intergenic
1153981652 18:10315503-10315525 CTCAGAGCAGAGATGGATGAAGG - Intergenic
1157077466 18:44480809-44480831 CAAAGCCCAGAGAAGGATGGAGG - Intergenic
1157349436 18:46871433-46871455 CTCAGAACAGGGAGGGAGGGAGG + Intronic
1158050499 18:53212206-53212228 CTCAATATGGAGAAGGATGTTGG - Intronic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1160054350 18:75465174-75465196 CCCAGGACATAGAAAGATGGAGG - Intergenic
1160596175 18:79975952-79975974 CACAGTAGAGAAAAGGATGAGGG + Intronic
1162796808 19:13091317-13091339 CTGAGTCCAGAGAAAGTTGGTGG + Intronic
1164887871 19:31798677-31798699 CTGAGGACAGGAAAGGATGGAGG - Intergenic
1165239484 19:34453880-34453902 ATCAGTAAAGAGAAGGTTGCTGG - Intronic
1165410542 19:35658090-35658112 CTCAGTATAAACAATGATGGAGG - Intronic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1166518744 19:43465404-43465426 CCCCGTACAGAGAAGGCTGTGGG - Intronic
1167408932 19:49333677-49333699 CTCAGGACAGAGAAGAGGGGTGG + Intergenic
1167439496 19:49500143-49500165 CTCCTTACAGCCAAGGATGGGGG + Intergenic
1167684405 19:50947105-50947127 CTGAATACAGAGAAGGGTGCTGG + Intronic
925210190 2:2038846-2038868 CTGAGTTCAGAGAAGGGTGAGGG - Intronic
927642794 2:24855939-24855961 CTCAGGACAGAGATAGAAGGGGG + Intronic
927838637 2:26422377-26422399 CTCCATGCATAGAAGGATGGAGG + Intronic
929087493 2:38182901-38182923 CTCAGAGCAGAGAAGGATTCTGG - Intergenic
929375393 2:41280948-41280970 CTCAGTAGAGAGTAGAATGGTGG + Intergenic
929441812 2:41970947-41970969 CCCAGCAAGGAGAAGGATGGTGG - Intergenic
929625304 2:43400666-43400688 CTCAGTACAGTTAAGAATGGTGG + Intronic
929870854 2:45758064-45758086 ACCAGTACAGAGAAGGCTGAGGG + Intronic
930166567 2:48209316-48209338 CACAGTACAGGGTAGCATGGAGG + Intergenic
930673598 2:54177141-54177163 CCCAGAACAGAGGTGGATGGAGG - Intronic
930924501 2:56800457-56800479 CTCAATAGAGGTAAGGATGGCGG - Intergenic
931246778 2:60498678-60498700 ATCAGTAAAGAGAAGGAAGCAGG + Intronic
932271361 2:70413059-70413081 CTCTGTAGGGAGGAGGATGGAGG + Intergenic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932895251 2:75633066-75633088 CTCAGTAGAGAAAAAGGTGGGGG + Intergenic
934611802 2:95743911-95743933 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
934670664 2:96210238-96210260 ATCAGTCCGGAGAAGGAAGGAGG - Intergenic
936545138 2:113385529-113385551 CTCACTGTAGAGAAGGAAGGAGG + Intergenic
939106956 2:137960252-137960274 CTCAATAATGAAAAGGATGGAGG + Intergenic
939265927 2:139872419-139872441 CCCAGTACAGAGACAGAGGGAGG - Intergenic
940224016 2:151382998-151383020 AGTAGTACAGAGAAGGGTGGAGG - Intergenic
940495662 2:154424782-154424804 CTCAGAAAAGACAAGTATGGTGG - Intronic
941797424 2:169615497-169615519 AGAAGTACAGAGAAGAATGGTGG - Intronic
1169078781 20:2781143-2781165 CTGAGTACAGACAAGGAGGGTGG - Intergenic
1169943656 20:10965299-10965321 CCTATGACAGAGAAGGATGGGGG + Intergenic
1170964507 20:21054013-21054035 CTCAGTTCAGAAAAGATTGGGGG + Intergenic
1173449869 20:43153818-43153840 CTCAGCACAGAGAAGGCAAGAGG + Intronic
1173571684 20:44081249-44081271 CTCACAAGAGAGAAGGATGTTGG - Intergenic
1174718401 20:52784857-52784879 CTCAGAACTGGGAAGGATGCTGG - Intergenic
1175288655 20:57857124-57857146 CTCAGAACAAAGAAAGATGGAGG - Intergenic
1175645483 20:60667238-60667260 CTGACATCAGAGAAGGATGGAGG - Intergenic
1175777220 20:61660959-61660981 TTCAGAGCAGAAAAGGATGGAGG - Intronic
1178342082 21:31794220-31794242 TTGAGTGGAGAGAAGGATGGCGG + Intergenic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1179116058 21:38493801-38493823 CACAGGACAGGGAAGGAAGGAGG - Intronic
1180374462 22:12077865-12077887 CACAGTATAGACAAGGCTGGGGG - Intergenic
1183980624 22:41537736-41537758 CTCAGGACAGATGAGGGTGGGGG + Intronic
1183983332 22:41555413-41555435 CTCAGCATTGAGAAGGCTGGAGG + Intergenic
1184122664 22:42462661-42462683 CTCAGTACACACAAGGAAAGGGG + Intergenic
1184846719 22:47092296-47092318 CACAGGACAGAGAGGTATGGAGG + Intronic
1185034067 22:48461669-48461691 CGCAGGACAGGGAAGGATGCGGG + Intergenic
1185132832 22:49049693-49049715 CTAAGTGCTGAGAAGGAGGGAGG + Intergenic
949106294 3:203833-203855 CCCAGAGCAGAGCAGGATGGAGG + Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950544913 3:13632474-13632496 CTCAGCACAGTGCAGGCTGGTGG + Intronic
952025948 3:29082469-29082491 CTGTGTCCAGGGAAGGATGGAGG + Intergenic
953383657 3:42492619-42492641 CTCACTGCAGAGGAGGGTGGAGG + Intronic
953475412 3:43201850-43201872 CACAAGACAGAGTAGGATGGGGG + Intergenic
953663719 3:44910123-44910145 CTCAGAACTGAGAAGGAGGAAGG - Exonic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
957952545 3:87144824-87144846 CACAGCACAGAGAAGCATAGCGG + Intergenic
958966565 3:100564905-100564927 ATCAGTACTGAGATGGAAGGTGG - Intronic
960699593 3:120427249-120427271 CAAAGTTCAGAGAAGGAAGGGGG - Intronic
960864179 3:122183894-122183916 CTCGGCACAGAGAACGTTGGTGG + Intronic
962008256 3:131369608-131369630 CTCAGTTTAGAGTAGGATGCTGG + Intergenic
962657655 3:137565096-137565118 GTCAGTAGACAGAAGGATAGAGG - Intergenic
965486240 3:169281988-169282010 TTCAGTAGAGAGGAGGATGTAGG - Intronic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
966287104 3:178311092-178311114 CTCACAACACAAAAGGATGGTGG + Intergenic
967873495 3:194251029-194251051 CTCAGGACATAGAAGGATACAGG + Intergenic
968951989 4:3700114-3700136 CTCAGCAAAGACAAAGATGGAGG + Intergenic
969032132 4:4223973-4223995 GACAGTGGAGAGAAGGATGGAGG + Intronic
969614527 4:8244624-8244646 ACCAGTACAGGGAAGGATGTGGG - Intergenic
971232456 4:24810838-24810860 CTCAGTGTTGAGAAGGATGCAGG + Intronic
971534489 4:27731869-27731891 CTCAGGATAGAGAAGGATTCAGG - Intergenic
972865340 4:43225482-43225504 CACTGCACAGAGCAGGATGGAGG + Intergenic
973253062 4:48081495-48081517 CTCAGTTTAGAGAAGTATGTGGG + Intronic
973713392 4:53651292-53651314 CGCAGTGCAGAGCAGGATGGGGG - Intronic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
974782124 4:66565799-66565821 TTCAGTAAAGAGAAGGATAGGGG + Intergenic
975241383 4:72064088-72064110 CCCAGGACAGAAGAGGATGGAGG + Intronic
975551019 4:75612514-75612536 CTTAGTACAGAGATGAATGTAGG + Intronic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976848526 4:89517737-89517759 CTCAGAGAATAGAAGGATGGAGG - Intergenic
981677104 4:147354879-147354901 TTCAATCCAGAGAAGAATGGGGG - Intergenic
981985258 4:150846558-150846580 CTCAGAACTCAGAAGGATGAGGG + Intronic
984030370 4:174596846-174596868 CTCAGTACAGTGAAGGAGAGAGG - Intergenic
984862233 4:184251633-184251655 CCCTGTACAGAGACAGATGGAGG + Intergenic
986225706 5:5810139-5810161 TCCAGTACAGAGAAAGATGTAGG - Intergenic
987017523 5:13835758-13835780 CCCAGTACAGAGACAGAGGGAGG - Intronic
987788175 5:22528824-22528846 ATTAGTAAAGAGAAGGCTGGTGG - Intronic
990305466 5:54490453-54490475 ATCAGTACAGTATAGGATGGTGG + Intergenic
990985621 5:61638601-61638623 CTCTGGACAGAGCAGGCTGGTGG + Intronic
992037947 5:72799587-72799609 GTCAGGAGAGAGAAGGCTGGAGG + Intergenic
992466556 5:77011889-77011911 ATCAGGAGAGAGAAGGAAGGAGG - Intergenic
995982144 5:118117255-118117277 GTCACTCCAGAGATGGATGGAGG + Intergenic
996578054 5:124998527-124998549 CTCTGTACAGAGACAGAGGGAGG + Intergenic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
998394138 5:141807187-141807209 CTTAAGACAGAGAAGGATGGAGG + Intergenic
998916581 5:147018871-147018893 CTCAGAACAGAAGATGATGGTGG + Intronic
1001060376 5:168483248-168483270 CTAAGTTCTGAGAAAGATGGAGG - Intergenic
1002184961 5:177450072-177450094 CTCTCTACAGACAAGGATGTAGG - Intronic
1002474576 5:179456666-179456688 GTCAGGACAAAGAAGGGTGGTGG + Intergenic
1002794858 6:464075-464097 CTAAGTGCAGAAAAGGACGGAGG - Intergenic
1003961494 6:11213310-11213332 ATCAGTGCAGAGAAGCATTGGGG - Exonic
1007285001 6:40741258-40741280 CAGAGTTCAGAGAAGGCTGGAGG - Intergenic
1007816558 6:44529242-44529264 ATCAGAACAGAGCAGGAGGGTGG + Intergenic
1007959622 6:45947012-45947034 CTCAGGACAGGGAAGGTAGGTGG + Intronic
1008845390 6:55957336-55957358 CCCCATACAGAGACGGATGGAGG + Intergenic
1009664579 6:66658715-66658737 TTCAGTATAGAAAAGAATGGAGG - Intergenic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1010630288 6:78190466-78190488 CTCAGGAGAGAGGAAGATGGGGG - Intergenic
1011232479 6:85178498-85178520 CTCAGAAAAGAGAGGGGTGGGGG - Intergenic
1012729131 6:102858064-102858086 AATAGTACAAAGAAGGATGGAGG - Intergenic
1015921205 6:138268109-138268131 CTCAGTCCAGAGATGGATACAGG - Intronic
1017111797 6:150939642-150939664 CGCAGTAGAGAGAAGGCAGGTGG - Intronic
1017883727 6:158581197-158581219 CTCAGTACTTAGGAAGATGGTGG + Intronic
1017985887 6:159442886-159442908 ATCAGGTCTGAGAAGGATGGAGG - Intergenic
1018793485 6:167168593-167168615 CGCAGCACAGAGAGGGATGCGGG + Intronic
1018823230 6:167389785-167389807 CGCAGCACAGAGAGGGATGCGGG - Intergenic
1021189665 7:17605194-17605216 ATCAGTAAAAAAAAGGATGGGGG + Intergenic
1021861543 7:24910810-24910832 CTAGGTAGAGAGAAGCATGGAGG + Intronic
1022598687 7:31736503-31736525 CCCAGGATAGAGAAGAATGGAGG - Intergenic
1022822969 7:33979458-33979480 CTAAGCACAGAGGAGGAGGGAGG - Intronic
1023207731 7:37769327-37769349 CCCAGTACAGAAAAGTATTGTGG - Intronic
1023634651 7:42197613-42197635 CTCAGTACAGAGAAGGATGGGGG + Intronic
1023991879 7:45133394-45133416 CTGAGTAAAGACAGGGATGGAGG + Intergenic
1024626923 7:51215801-51215823 CACAGGACAGAGAGGGATGAGGG + Intronic
1024698533 7:51882226-51882248 CTCAGTAGAGCCAAGGATGCAGG - Intergenic
1026537195 7:71248726-71248748 CTAAGAACAAAGAAGCATGGGGG - Intronic
1027953171 7:84846136-84846158 ATATGTACAGAGAATGATGGGGG + Intergenic
1029409890 7:100402338-100402360 TTCAGTACAGAGAAGCAAAGGGG + Intronic
1030389530 7:108908992-108909014 GTCAGTACAGAGATGTGTGGGGG + Intergenic
1030624955 7:111834364-111834386 CTCATTTCAGAGAAGGATATAGG - Intronic
1034003328 7:147441876-147441898 CTCAGAACAGAGAGAGACGGAGG - Intronic
1035307008 7:157939879-157939901 CTCAGCACAGAGCAGAGTGGAGG + Intronic
1035886456 8:3296380-3296402 CTGAGAGCAGAGAAGAATGGGGG + Intronic
1036505007 8:9347301-9347323 CTCACTGCAGAGAAATATGGGGG + Intergenic
1038333252 8:26626460-26626482 TTCAGTACAGAGAAAGAGAGAGG - Intronic
1040032529 8:42839198-42839220 CTCAGTACAAAGAAATATTGTGG + Exonic
1040562022 8:48531410-48531432 CTGAGTGCAGGGGAGGATGGGGG - Intergenic
1040807218 8:51408261-51408283 CTCAGGACTGAGAAGGTAGGAGG + Exonic
1042998253 8:74725281-74725303 AGCAGTATAAAGAAGGATGGAGG + Intronic
1043312973 8:78885788-78885810 CTCAGTGCTGGGATGGATGGTGG + Intergenic
1044843966 8:96362018-96362040 CTCAGTGCACACAAGCATGGAGG + Intergenic
1045264368 8:100606653-100606675 CTCAGGAGAGAGAGAGATGGTGG - Intronic
1046823745 8:118663789-118663811 CTCAGCACAGAGCAGGGTAGAGG + Intergenic
1047507244 8:125489507-125489529 CTCAGCAGGGAGGAGGATGGTGG - Intergenic
1049560189 8:143306476-143306498 CTCAGGACACAGCAGGGTGGGGG - Intronic
1049738092 8:144220771-144220793 CTCAGTCCAGCCAAGGGTGGTGG - Intronic
1050263842 9:3869748-3869770 CTCAGTACATGGCAGTATGGAGG + Intronic
1051686209 9:19660563-19660585 CTAAGTAAAGAGAAAGATTGAGG + Intronic
1053316103 9:37053002-37053024 CTGAGGACAGAGAGGGATAGAGG - Intergenic
1055848750 9:80599292-80599314 CTCAGCACAGTGAAAGAGGGTGG - Intergenic
1059011443 9:110466191-110466213 CTTAGTATAGAGAAGCATGGTGG - Intronic
1059464546 9:114459566-114459588 CTCAGTCCAGAGAAGGCAAGTGG + Intronic
1060878591 9:127101510-127101532 CTCAGGATGGTGAAGGATGGAGG - Intronic
1186800070 X:13083932-13083954 CTCTGTACAGAGACAGAGGGAGG + Intergenic
1186954298 X:14664795-14664817 CTCTTTAAAGAGAAGGCTGGAGG + Intronic
1187245551 X:17550345-17550367 CTCACTAAAGATAAGGCTGGTGG + Intronic
1187474035 X:19593904-19593926 CTCAATGCAAACAAGGATGGGGG + Intronic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190398212 X:50006122-50006144 TTCAGTTGAGAGATGGATGGAGG + Intronic
1192103613 X:68291664-68291686 TTCAGAACACAGAAGGATGTGGG - Intronic
1193048497 X:77077621-77077643 TTCATTCCAGAGAAGGATGTTGG + Intergenic
1195660683 X:107374939-107374961 CTCAGAGAAGAGAAGAATGGTGG - Intergenic
1198957503 X:142148694-142148716 ATCAGTGCAGAGGAGGATGGGGG + Intergenic
1199117489 X:144009460-144009482 CTCAGTAGATAGAAAGATGTGGG - Intergenic
1199268692 X:145857681-145857703 CTCTGTAGAGAGAAGGATGCTGG - Intergenic
1200274381 X:154717943-154717965 TTGAGCACAGAGAAGGATGACGG + Intronic
1201646191 Y:16235105-16235127 CACAGAACAGAGAAGAATGTGGG + Intergenic
1201656622 Y:16350212-16350234 CACAGAACAGAGAAGAATGTGGG - Intergenic