ID: 1023635755

View in Genome Browser
Species Human (GRCh38)
Location 7:42208494-42208516
Sequence GCATTTACAGGCGGGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023635755_1023635764 19 Left 1023635755 7:42208494-42208516 CCCCAGCTCCCGCCTGTAAATGC 0: 1
1: 0
2: 1
3: 12
4: 181
Right 1023635764 7:42208536-42208558 ACAAATATGGGTTACTTGAGAGG No data
1023635755_1023635762 6 Left 1023635755 7:42208494-42208516 CCCCAGCTCCCGCCTGTAAATGC 0: 1
1: 0
2: 1
3: 12
4: 181
Right 1023635762 7:42208523-42208545 GAAAGAATAAATTACAAATATGG No data
1023635755_1023635763 7 Left 1023635755 7:42208494-42208516 CCCCAGCTCCCGCCTGTAAATGC 0: 1
1: 0
2: 1
3: 12
4: 181
Right 1023635763 7:42208524-42208546 AAAGAATAAATTACAAATATGGG 0: 1
1: 0
2: 11
3: 147
4: 1591

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023635755 Original CRISPR GCATTTACAGGCGGGAGCTG GGG (reversed) Intronic
900564021 1:3323608-3323630 GGGTTTCCAGGCGGGAGCTGGGG - Intronic
901031565 1:6310182-6310204 CCACTTGGAGGCGGGAGCTGAGG + Intronic
902722339 1:18312270-18312292 GCATCTACTGGCAGGAGCAGGGG + Intronic
902874351 1:19331912-19331934 GCACTTTCAGGCAGGAGCTATGG + Intergenic
903667636 1:25017632-25017654 TCATTTAGAGGCGGGAGCTGAGG - Intergenic
904807751 1:33143637-33143659 TCATCTACAGCCTGGAGCTGGGG - Intergenic
905933204 1:41804239-41804261 GCAGGTACAGGCAGGGGCTGTGG - Intronic
907321416 1:53605132-53605154 GATTTTACAGGGTGGAGCTGAGG + Intronic
907407962 1:54265348-54265370 GTGTTTACAGGCCAGAGCTGGGG + Intronic
907911797 1:58833716-58833738 ACTTTTACAGTCAGGAGCTGGGG - Intergenic
910586179 1:88882037-88882059 GAGTTTACAGGCGTGAGCTATGG - Intronic
911776527 1:101820301-101820323 GCACTAACAGGAGGGAGTTGGGG + Intronic
914193506 1:145431295-145431317 GCCGTTGCAGGCGGGAGTTGGGG + Intergenic
914474835 1:148014185-148014207 GCCGTTGCAGGCGGGAGTTGGGG + Intergenic
916729059 1:167550274-167550296 GCATATAGAGGCGGGTGCGGAGG - Intronic
919556132 1:199056436-199056458 GCATTTACGGTCGGGCGCGGTGG + Intergenic
919572239 1:199263412-199263434 GCAATTACAGGCAGGAGCCACGG - Intergenic
924943389 1:248827701-248827723 GCATTTTCATGGGGGAGCTGGGG + Intergenic
1063164274 10:3445687-3445709 GCAATTTCAGGCAGGAACTGCGG + Intergenic
1069729220 10:70600351-70600373 GCTTCTACAGGTGAGAGCTGGGG - Exonic
1073674803 10:105633694-105633716 GCATTAAGAGGTGGGATCTGTGG + Intergenic
1073748664 10:106499210-106499232 ACATTTATGGGCGGGAGCGGGGG - Intergenic
1074524088 10:114249555-114249577 TCACTTACAAGTGGGAGCTGAGG - Intronic
1074710669 10:116174955-116174977 GCATTTGCAGGCAGGATCCGTGG - Intronic
1075166177 10:120070187-120070209 GAATTTACAAACAGGAGCTGGGG - Intergenic
1075701783 10:124474665-124474687 CCATTTACAGATGGGACCTGTGG - Intronic
1079206094 11:18415963-18415985 GGAATTACAGGTGTGAGCTGCGG + Intronic
1083118460 11:60488273-60488295 GGGTTTCCAGCCGGGAGCTGTGG + Intergenic
1084690137 11:70720362-70720384 AGATTGACAGGCGGGGGCTGTGG - Intronic
1084722246 11:70914396-70914418 GCATGGACAGGTGGGAGGTGTGG - Intronic
1086946872 11:92852483-92852505 GCATTTCCAGGCTGGAACTCAGG + Intronic
1087168504 11:95027031-95027053 TCATTGGCAAGCGGGAGCTGAGG - Exonic
1089062392 11:115636362-115636384 GCATTTTCAGCCGGGCGCAGTGG + Intergenic
1089896946 11:121940172-121940194 GGATTAACAGGCGTGAGCCGTGG + Intergenic
1090106223 11:123855457-123855479 GCATCTGCAGGAGGCAGCTGGGG - Intergenic
1090295252 11:125581925-125581947 GGAATTACAGGCGTGAGCCGTGG - Intronic
1091412523 12:253546-253568 TTCTTTACAGGCTGGAGCTGAGG + Intronic
1093432995 12:19105115-19105137 ACATTTCCAGCCGGGAGCAGTGG - Intergenic
1093976355 12:25426489-25426511 GCATTTCCAGATGGGCGCTGTGG + Intronic
1096987743 12:55772611-55772633 GCTTTTAAAGGAGGGAGATGGGG - Intronic
1101352174 12:103941272-103941294 TCCTTTACTGGCGGGAGGTGGGG - Intronic
1103585831 12:121955013-121955035 ACATTTACAGCTGGGAGCGGTGG + Intronic
1103894852 12:124266213-124266235 GCTGTCACTGGCGGGAGCTGGGG - Intronic
1105241110 13:18610235-18610257 TCATTCACACCCGGGAGCTGAGG + Intergenic
1105708529 13:22983358-22983380 CCATTTCCAGGTGGCAGCTGTGG - Intergenic
1108504708 13:51102175-51102197 TCAGTTACTGGCGGGGGCTGGGG - Intergenic
1108676167 13:52739433-52739455 GCATCCACAGGCGGGTGCGGAGG - Intronic
1110309800 13:74036050-74036072 GCATTCTGAGGCAGGAGCTGGGG - Intronic
1115532985 14:34344046-34344068 GGGATTACAGGCGTGAGCTGCGG - Intronic
1116689671 14:48089402-48089424 GGGATTACAGGCGTGAGCTGCGG - Intergenic
1117141856 14:52797311-52797333 GGGATTACAGGCGTGAGCTGTGG - Intergenic
1121917780 14:97851883-97851905 GCATACTCAGGCGGGGGCTGGGG - Intergenic
1122059358 14:99126290-99126312 GCCTTGACAGGCTGGAGCAGAGG + Intergenic
1122605864 14:102947398-102947420 GCACTGCCAGGCGGGCGCTGTGG - Intronic
1123490246 15:20774911-20774933 TCATTCACACCCGGGAGCTGAGG - Intergenic
1123546747 15:21343998-21344020 TCATTCACACCCGGGAGCTGAGG - Intergenic
1125706827 15:41745166-41745188 ACATTTACAGCCAGGCGCTGTGG - Intronic
1126014838 15:44340526-44340548 GGGATTATAGGCGGGAGCTGTGG + Intronic
1126230887 15:46322834-46322856 GCAGTCTCAGGCTGGAGCTGGGG + Intergenic
1126755399 15:51920775-51920797 GGAATTACAGGCGTGAGCTATGG - Intronic
1127622007 15:60743300-60743322 GCATTTACAGCCGGGTGCGGTGG - Intronic
1202955079 15_KI270727v1_random:71214-71236 TCATTCACACCCGGGAGCTGAGG - Intergenic
1132471281 16:104841-104863 GGATTTACAGGCTGGAGGTTGGG - Intronic
1132629877 16:912021-912043 CCATTGACAGACGCGAGCTGTGG - Intronic
1134386094 16:13773971-13773993 GCAATTACAGGCGTGAGCCACGG - Intergenic
1134483025 16:14634556-14634578 GGGATTACAGGCGTGAGCTGCGG - Intronic
1134672825 16:16068299-16068321 GCAGGTACAGGGGGAAGCTGGGG + Exonic
1135846340 16:25922023-25922045 GCAATTACAGGCGTGAGCCATGG + Intronic
1136356890 16:29750049-29750071 GCAGTTACAGGGGGAAGCTAAGG + Intergenic
1137615311 16:49842703-49842725 GGAATTACAGGCGTGAGCTACGG - Intronic
1137754147 16:50888106-50888128 GCATTTGCAGTCTGGAGCAGAGG + Intergenic
1141756730 16:85996308-85996330 GCATTCCCAAGCGGCAGCTGTGG - Intergenic
1145164938 17:20606408-20606430 GCATTTTAAGCCGGGAGCGGTGG + Intergenic
1145361425 17:22215467-22215489 GCATTTACAGGCATGAGCCACGG + Intergenic
1147597189 17:41724785-41724807 CCCATTACAGGCGGCAGCTGAGG - Exonic
1152151996 17:78607446-78607468 GCATTTGCAGGGGAGAGCTTGGG - Intergenic
1152624132 17:81380472-81380494 TCATTTAAAGGTGGGAACTGGGG - Intergenic
1160437348 18:78861882-78861904 GCAGAGACGGGCGGGAGCTGGGG + Intergenic
1161109068 19:2458910-2458932 GCAGTTACAGGCGTGAGCCACGG + Intergenic
1161337352 19:3721729-3721751 GCAGGTGCAGCCGGGAGCTGCGG + Exonic
1161477363 19:4494048-4494070 GCAGTGACAGGTGGGTGCTGGGG + Exonic
1164423318 19:28116994-28117016 GCAAATTCAGGTGGGAGCTGGGG - Intergenic
1165576344 19:36822808-36822830 GCAATTACAGGCGTGAGCCACGG + Intronic
1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG + Intronic
1167279727 19:48559848-48559870 GGGATTACAGGCGTGAGCTGTGG - Intronic
1167340470 19:48912942-48912964 CCATTTACAGGCTGGAATTGGGG + Intronic
1167585919 19:50375823-50375845 GGGATTACAGGCGTGAGCTGCGG - Intronic
1168427779 19:56252852-56252874 GCAGCCACAGGCAGGAGCTGGGG + Intronic
926198611 2:10778072-10778094 GCAGTGTCAGGCGGGAGCTCGGG + Intronic
926298375 2:11584764-11584786 ACATTTACAGCCGGGCGCGGTGG + Intronic
927863449 2:26574568-26574590 GAACTCCCAGGCGGGAGCTGTGG + Intronic
929970313 2:46568650-46568672 GCATTTAAGGGTGGGAGCCGTGG - Intronic
930017309 2:46979758-46979780 GGACTCCCAGGCGGGAGCTGAGG + Intronic
930233489 2:48866353-48866375 GCATTTAGAGTTTGGAGCTGAGG - Intergenic
930719964 2:54629290-54629312 TCATTTACATCCGGGAGCAGTGG + Exonic
932594662 2:73086593-73086615 GCATTTGCTGGGAGGAGCTGAGG - Intronic
937228117 2:120381462-120381484 ACCTTTACAGGTGGGAGCTTGGG - Intergenic
941736222 2:168979819-168979841 CCATTAACAGGTGGGGGCTGGGG - Intronic
943272550 2:185825602-185825624 GAATTTAGAGGCAGGAGATGTGG - Intronic
946315541 2:218909102-218909124 GCGTTTACAGGCCGGAAGTGAGG + Intergenic
946320058 2:218947986-218948008 GGAATTACAGGCGGGAGCCACGG - Intergenic
948693664 2:239722089-239722111 GGATATACAGGTGGGGGCTGGGG + Intergenic
1170713010 20:18808926-18808948 GCATGAACAAGCAGGAGCTGGGG - Intergenic
1171101763 20:22390309-22390331 GCATTTGCTGGCTGGAGCTGCGG + Intergenic
1171458287 20:25283970-25283992 GGGTATACAGGCTGGAGCTGAGG - Intronic
1172190210 20:33057457-33057479 GGGATTACAGGCGTGAGCTGGGG + Intronic
1172413331 20:34742693-34742715 GAATTTACAGGGGGTTGCTGGGG + Exonic
1173221507 20:41136575-41136597 GCATTTGCAGGAGGGCGCTGCGG + Intergenic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1176448362 21:6841009-6841031 TCATTCACACCCGGGAGCTGAGG + Intergenic
1176826532 21:13706031-13706053 TCATTCACACCCGGGAGCTGAGG + Intergenic
1178483755 21:33004025-33004047 GCACTCCCAGGAGGGAGCTGCGG + Intergenic
1179714859 21:43281437-43281459 GCATCTATAGGCGTGCGCTGTGG + Intergenic
1181510327 22:23386104-23386126 GCAGGTACGGGCTGGAGCTGTGG - Intergenic
1184745006 22:46451062-46451084 GCAGTTCCCGGTGGGAGCTGGGG - Intronic
950370306 3:12523808-12523830 GGAATTACAGGCGTGAGCCGTGG + Intronic
950951333 3:17003451-17003473 GCATTCACAGGTGAGAGCTGAGG - Intronic
953261722 3:41345913-41345935 GAATTTGCAGGGGGGAGGTGAGG + Intronic
954808335 3:53232922-53232944 GCATGTACAGGCAGGAGGAGAGG - Intronic
957549410 3:81684578-81684600 GTATTTGCAGGCGGGGGCTTTGG - Intronic
960972345 3:123148923-123148945 GCATTTACAGGCAGGTGCATAGG + Intronic
961003389 3:123388969-123388991 GCCTCTACAGGAGGGACCTGGGG + Intronic
961759227 3:129153278-129153300 GCAGTTACAGGCGTGAGCCACGG + Intronic
962019592 3:131484415-131484437 GGATTTATAGGCTGGAGCAGTGG - Intronic
962538109 3:136349881-136349903 GGATTTACAGGCGTGAGCCACGG - Intronic
964930266 3:162011425-162011447 GCTTATACAGGCGGCAGCAGTGG + Intergenic
965190335 3:165519796-165519818 TTATTTGCAGGCGGGGGCTGGGG + Intergenic
965665822 3:171092233-171092255 GCATTTGCAGCCGGGCGCGGTGG - Intronic
965783736 3:172315087-172315109 GAATTTACAGCCGGGCGCGGTGG + Intronic
966790189 3:183660785-183660807 GGTATTACAGGCGTGAGCTGCGG - Intronic
966962867 3:184957980-184958002 GCAGATAGAGGCGGGAGCAGAGG + Intronic
967850951 3:194082328-194082350 GCATTTGCAGGCGGGGCCTTTGG + Intergenic
968557647 4:1255667-1255689 GCAGTTACTGGCGGGGGCTTTGG - Intergenic
968836636 4:2969645-2969667 GGATTTACAGGCGTGAGCCATGG + Intronic
969585208 4:8087564-8087586 GAATTAACAGAGGGGAGCTGAGG + Intronic
969639318 4:8387601-8387623 GGCTTTACAGACGGGGGCTGTGG + Intronic
981314890 4:143332335-143332357 GAATTTCCTGGCGGGCGCTGTGG + Intergenic
981323794 4:143423957-143423979 TCATTTACAGGTGGGAGAAGTGG + Intronic
983575960 4:169262394-169262416 GGGATTACAGGCGTGAGCTGCGG - Intronic
984658523 4:182346844-182346866 GACTTGACAGGCAGGAGCTGCGG - Exonic
985528795 5:421677-421699 GCATTCACAGAAGGGAACTGCGG + Intronic
986276643 5:6281057-6281079 GCTTTTACAGTGGGGAGCTCAGG - Intergenic
989541532 5:42624262-42624284 GCATTTCCAGGCCAGAGCTTTGG + Intronic
991176834 5:63698432-63698454 TCATTTACAGGAGTGACCTGTGG + Intergenic
991499163 5:67258898-67258920 TCTTTTACAGCGGGGAGCTGTGG - Intergenic
991568527 5:68030377-68030399 GCATTTACAAGGGGGAGCTATGG - Intergenic
992792661 5:80227471-80227493 GTGTTTACAGCCGGGAGCAGCGG + Intronic
994070481 5:95596026-95596048 GCATTAACAGGCAGAAACTGAGG + Intronic
994451394 5:99949491-99949513 GGAGCTCCAGGCGGGAGCTGGGG - Intergenic
994631520 5:102294177-102294199 GCAATTACAGGCGTGAGCCACGG + Intronic
994805599 5:104443841-104443863 GGGATTACAGGCGGGAGCAGCGG - Intergenic
996759947 5:126976838-126976860 GCATTTCCAGGCAGGATGTGTGG - Intronic
997949418 5:138230416-138230438 GCCTTCAGAGGCAGGAGCTGGGG - Intergenic
999132873 5:149298003-149298025 GCCTTTACAGGAGGAAACTGAGG + Intronic
1003154723 6:3581664-3581686 GGATTTAATGGCTGGAGCTGTGG + Intergenic
1003315897 6:5011546-5011568 CCCCTCACAGGCGGGAGCTGGGG + Intergenic
1005805792 6:29473392-29473414 GCATTGACGGGATGGAGCTGGGG + Intergenic
1006447526 6:34088090-34088112 GCACATACAGGCGGGAGCTCAGG - Intronic
1007020133 6:38511627-38511649 GTATTTACAGCCAGGAGCGGTGG - Intronic
1007135683 6:39519748-39519770 GAATTTACAGGCATGAGCCGCGG - Intronic
1007740865 6:44008740-44008762 GCACTTACAGGCCCGAGCTATGG - Intergenic
1008868013 6:56238495-56238517 GCAGTTACAAGCGAGACCTGAGG + Intronic
1009279027 6:61722977-61722999 GGAATTACAGGCATGAGCTGCGG + Intronic
1009442635 6:63699857-63699879 GGCATTACAGGCGTGAGCTGCGG + Intronic
1009444335 6:63722753-63722775 CCATTTGCAGGAGGGAGGTGTGG - Intronic
1010286880 6:74088933-74088955 GATTTTACAGCCGGGAGCAGTGG - Intergenic
1013316386 6:108947142-108947164 GCATGGGCAGGAGGGAGCTGGGG + Intronic
1018159046 6:161019677-161019699 GGGATTACAGGCGTGAGCTGTGG + Intronic
1021873140 7:25023252-25023274 TCACTTACAAGCGTGAGCTGTGG - Intergenic
1023635755 7:42208494-42208516 GCATTTACAGGCGGGAGCTGGGG - Intronic
1028384389 7:90238262-90238284 GCATTTCCAGGCAGCAGCTGGGG - Intergenic
1029379092 7:100200960-100200982 GCTGTTACAGGTAGGAGCTGGGG + Exonic
1034210311 7:149357549-149357571 GCATTTTCTGGTGTGAGCTGTGG - Intergenic
1034621186 7:152458369-152458391 GCATTTCCAGGCGGGGGCGGTGG + Intergenic
1034757191 7:153633677-153633699 GCATTTAGAGACGGGAGAAGAGG + Intergenic
1036146788 8:6261457-6261479 GGGATTACAGGCGTGAGCTGTGG - Intergenic
1036557484 8:9872973-9872995 GGAATTACAGGCGTGAGCTATGG + Intergenic
1037962063 8:23105215-23105237 CACTTTACAGGCAGGAGCTGGGG - Intronic
1037969390 8:23161194-23161216 CACTTTACAGGCAGGAGCTGGGG + Intronic
1038335200 8:26640517-26640539 ACATTCACAGGAGGGTGCTGTGG - Intronic
1042346373 8:67732218-67732240 GCACATACAGGTGGCAGCTGTGG + Intronic
1042867769 8:73370568-73370590 GAATTGACAGGCCGGAGGTGGGG - Intergenic
1052196544 9:25723359-25723381 GCGATTACAGGCGTGAGCTACGG - Intergenic
1055447839 9:76400580-76400602 GAATGTAGAGGCAGGAGCTGAGG - Intergenic
1056053844 9:82799978-82800000 GCATTTAAAAGCAGGAGCTTTGG + Intergenic
1059471476 9:114507991-114508013 GCATTCACTGGCCAGAGCTGGGG - Intergenic
1061723479 9:132568265-132568287 GCATATACAGCTGGGCGCTGTGG + Intronic
1062607211 9:137353657-137353679 GCATTTCCCAGCGGGGGCTGAGG - Intronic
1203520829 Un_GL000213v1:43509-43531 TCATTCACACCCGGGAGCTGAGG - Intergenic
1185869241 X:3649867-3649889 GGGATTACAGGCGGGAGCTACGG - Intronic
1186765584 X:12767636-12767658 TCATTTGGAGGCGGGGGCTGGGG - Intergenic
1195305325 X:103576491-103576513 GGGATTACAGGCGTGAGCTGCGG - Intronic