ID: 1023640376

View in Genome Browser
Species Human (GRCh38)
Location 7:42251120-42251142
Sequence GTACTGTCCTGGGGCAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023640370_1023640376 -8 Left 1023640370 7:42251105-42251127 CCATGCCCTTGTTAAGTACTGTC No data
Right 1023640376 7:42251120-42251142 GTACTGTCCTGGGGCAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023640376 Original CRISPR GTACTGTCCTGGGGCAACAC TGG Intergenic
No off target data available for this crispr